ID: 1017524754

View in Genome Browser
Species Human (GRCh38)
Location 6:155232694-155232716
Sequence GGGTCGGCATGCGGAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524746_1017524754 2 Left 1017524746 6:155232669-155232691 CCAGGCCTATGGCTCAACACAGA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1017524754 6:155232694-155232716 GGGTCGGCATGCGGAGGGAGAGG 0: 1
1: 0
2: 0
3: 21
4: 272
1017524748_1017524754 -3 Left 1017524748 6:155232674-155232696 CCTATGGCTCAACACAGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 109
Right 1017524754 6:155232694-155232716 GGGTCGGCATGCGGAGGGAGAGG 0: 1
1: 0
2: 0
3: 21
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524754 Original CRISPR GGGTCGGCATGCGGAGGGAG AGG Intronic