ID: 1017524755 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:155232695-155232717 |
| Sequence | GGTCGGCATGCGGAGGGAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 218 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 14, 4: 202} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017524748_1017524755 | -2 | Left | 1017524748 | 6:155232674-155232696 | CCTATGGCTCAACACAGAGTGGG | 0: 1 1: 0 2: 1 3: 20 4: 109 |
||
| Right | 1017524755 | 6:155232695-155232717 | GGTCGGCATGCGGAGGGAGAGGG | 0: 1 1: 0 2: 1 3: 14 4: 202 |
||||
| 1017524746_1017524755 | 3 | Left | 1017524746 | 6:155232669-155232691 | CCAGGCCTATGGCTCAACACAGA | 0: 1 1: 0 2: 0 3: 9 4: 113 |
||
| Right | 1017524755 | 6:155232695-155232717 | GGTCGGCATGCGGAGGGAGAGGG | 0: 1 1: 0 2: 1 3: 14 4: 202 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017524755 | Original CRISPR | GGTCGGCATGCGGAGGGAGA GGG | Intronic | ||