ID: 1017524756 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:155232708-155232730 |
Sequence | AGGGAGAGGGATCTCCCGCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 149 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 137} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1017524748_1017524756 | 11 | Left | 1017524748 | 6:155232674-155232696 | CCTATGGCTCAACACAGAGTGGG | 0: 1 1: 0 2: 1 3: 20 4: 109 |
||
Right | 1017524756 | 6:155232708-155232730 | AGGGAGAGGGATCTCCCGCCAGG | 0: 1 1: 0 2: 0 3: 11 4: 137 |
||||
1017524746_1017524756 | 16 | Left | 1017524746 | 6:155232669-155232691 | CCAGGCCTATGGCTCAACACAGA | 0: 1 1: 0 2: 0 3: 9 4: 113 |
||
Right | 1017524756 | 6:155232708-155232730 | AGGGAGAGGGATCTCCCGCCAGG | 0: 1 1: 0 2: 0 3: 11 4: 137 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1017524756 | Original CRISPR | AGGGAGAGGGATCTCCCGCC AGG | Intronic | ||