ID: 1017524757

View in Genome Browser
Species Human (GRCh38)
Location 6:155232709-155232731
Sequence GGGAGAGGGATCTCCCGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017524746_1017524757 17 Left 1017524746 6:155232669-155232691 CCAGGCCTATGGCTCAACACAGA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1017524757 6:155232709-155232731 GGGAGAGGGATCTCCCGCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 115
1017524748_1017524757 12 Left 1017524748 6:155232674-155232696 CCTATGGCTCAACACAGAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 109
Right 1017524757 6:155232709-155232731 GGGAGAGGGATCTCCCGCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524757 Original CRISPR GGGAGAGGGATCTCCCGCCA GGG Intronic