ID: 1017524939

View in Genome Browser
Species Human (GRCh38)
Location 6:155234381-155234403
Sequence GCCTCAGCATCGTTAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119664
Summary {0: 1, 1: 0, 2: 40, 3: 3509, 4: 116114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017524939 Original CRISPR GCCTCAGCATCGTTAGTGGC TGG Intronic
Too many off-targets to display for this crispr