ID: 1017525741

View in Genome Browser
Species Human (GRCh38)
Location 6:155240127-155240149
Sequence CACCCAGTCCCCTCAATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017525741 Original CRISPR CACCCAGTCCCCTCAATGGT TGG (reversed) Intronic
900137473 1:1124463-1124485 CACCCAGTCCGCTCACTGCTTGG + Intergenic
900163455 1:1235444-1235466 GACACTGTCCCCTCCATGGTAGG - Intergenic
900963554 1:5941838-5941860 CCCCCTGTCTCCTCACTGGTGGG - Intronic
902852145 1:19167667-19167689 GACCTAGTCCCTACAATGGTGGG + Intronic
905548401 1:38817792-38817814 CACCCAGAACCCACAATGGCAGG - Intergenic
908602869 1:65759689-65759711 CAACCAGTCTTCTAAATGGTGGG - Intergenic
911114264 1:94228641-94228663 CACCCAGGCCCCTCAAAGGCAGG - Intronic
920421603 1:205838000-205838022 CCCCCAACCCCCTCAATGCTGGG + Intronic
1065857588 10:29842792-29842814 CTGCCAGCCACCTCAATGGTGGG - Intergenic
1070721905 10:78762792-78762814 CTCCAAGTCCCCTCAGTGATGGG + Intergenic
1071443358 10:85723910-85723932 CATCCAGACCCCTCAGAGGTAGG + Intronic
1076678137 10:132158579-132158601 CCCCCAGTCCCCTCCAGAGTAGG - Intronic
1079334806 11:19561978-19562000 CACCCAGGCCCATCAATGGCAGG - Intronic
1081788654 11:45767127-45767149 CCCACAATCCCCTCATTGGTTGG + Intergenic
1085389990 11:76177426-76177448 GACCCAGGCCCCTCTCTGGTAGG + Intergenic
1085871686 11:80357731-80357753 CACCCAGTCCCATCAATGTGAGG + Intergenic
1089871080 11:121673110-121673132 CACCCTGGCCCCTCAGTGCTAGG + Intergenic
1090588533 11:128239567-128239589 CACACAGTCCCCCCATTGGCAGG - Intergenic
1090995406 11:131861347-131861369 CACCCAAGCCCCTCACTGCTGGG - Intronic
1094435761 12:30419243-30419265 GAACCAGTCCCCTCCATGTTGGG + Intergenic
1096320649 12:50609672-50609694 TTCCCAGTCCCCTCATAGGTAGG - Intronic
1102946057 12:116989308-116989330 TAGCCAGGCCCCTCACTGGTAGG + Intronic
1104791522 12:131485275-131485297 CAACCAGTACCCTCCCTGGTAGG + Intergenic
1109393623 13:61725446-61725468 CATCCAGACCCCAGAATGGTAGG - Intergenic
1116695663 14:48173986-48174008 CACCCAGTCCCCAAATTGCTGGG - Intergenic
1120633624 14:86923812-86923834 AAACCAGTCCCCACAAAGGTTGG + Intergenic
1120654120 14:87169127-87169149 CCTCCAGTCCCCAGAATGGTAGG - Intergenic
1122578327 14:102755684-102755706 CACCCAGGGCCCTCCATGCTCGG - Intergenic
1131434403 15:92411711-92411733 TCCACAGTCACCTCAATGGTGGG + Intronic
1132540999 16:509719-509741 CTCCCAGTCCCCTCCAGGCTGGG - Intronic
1132677214 16:1125776-1125798 CACCCAGTCCCCTCAGAGCCTGG - Intergenic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133769819 16:8861419-8861441 CCCCCAGTCCCCTCATTTATAGG + Intronic
1135043532 16:19136130-19136152 CCACCAGTCCCATCCATGGTTGG - Intronic
1136775904 16:32871703-32871725 CCCCCAGTCCCTTTAATGGAGGG - Intergenic
1136894712 16:33989809-33989831 CCCCCAGTCCCTTTAATGGAGGG + Intergenic
1138282617 16:55783680-55783702 CACACTGTCCCCTACATGGTCGG + Intergenic
1138286327 16:55812940-55812962 CACACTGTCCCCTACATGGTCGG - Exonic
1139378862 16:66517694-66517716 CACCCACTGCCCCCAAGGGTTGG + Intronic
1203078320 16_KI270728v1_random:1133812-1133834 CCCCCAGTCCCTTTAATGGAGGG - Intergenic
1145047595 17:19630165-19630187 CAGCCAGGCCCCTCTAAGGTGGG - Intergenic
1146283918 17:31561631-31561653 CAGCCGGTCCCCTCCAGGGTGGG - Intergenic
1147134107 17:38425460-38425482 GACCCAGGCCCCTCAAGGGAAGG + Intergenic
1147615304 17:41823801-41823823 CACCCCGTCCTCACAATGCTCGG - Intergenic
1151798842 17:76365376-76365398 CAGCCAGCCCCCTCAGTGGGTGG - Intronic
1152121802 17:78423455-78423477 CGCCCTGTCCCCTCATTGGCAGG + Intronic
1152588226 17:81198553-81198575 CTCCCAGGCTGCTCAATGGTGGG - Intronic
1157437764 18:47685633-47685655 CTCCCTGTTCCATCAATGGTTGG - Intergenic
1158597770 18:58831241-58831263 CACACAGGCCCCTCAATGCCGGG + Intergenic
1158935833 18:62363880-62363902 CATCCAGTTCACTAAATGGTAGG - Intronic
1160014250 18:75128341-75128363 CACCCAGGCCCTGCTATGGTTGG - Intergenic
1160102240 18:75933884-75933906 GAGCCTCTCCCCTCAATGGTTGG - Intergenic
1165326406 19:35116778-35116800 CACCCAGATCCCTCAATGTCTGG - Intronic
927865625 2:26585488-26585510 CACCCAAGCCCCTCACTGGATGG + Intronic
932211638 2:69936329-69936351 GACCCAGTCCCCTCCCTCGTGGG - Intronic
946848743 2:223884734-223884756 CCCCCAGGCTCCTCAGTGGTTGG - Exonic
1177599265 21:23289355-23289377 CATCCAGACCCCAGAATGGTAGG + Intergenic
1178066133 21:28906459-28906481 CACCCATTCCCCTCAATGAAGGG - Intergenic
1179549698 21:42136022-42136044 CACCCAGTCCCCTCCATCTCAGG - Intronic
1182821923 22:33223907-33223929 CACCCAGCCCCACCATTGGTCGG + Intronic
1184060838 22:42079993-42080015 CACGCACTCCCCACAATGATTGG - Intronic
949093303 3:55487-55509 CACCTAGTCCCCTAAGTGCTAGG + Intergenic
950559399 3:13713147-13713169 CACATGGTTCCCTCAATGGTAGG - Intergenic
951227157 3:20133774-20133796 TACCCAGTGCCAGCAATGGTAGG - Intronic
953423005 3:42769754-42769776 CACCCAGAACCCTCACTGGCCGG - Intronic
955679007 3:61480836-61480858 CACCAAGTCCCCTCTACAGTGGG + Intergenic
957033552 3:75271565-75271587 CACCTAGTCCCCTAAGTGCTAGG + Intergenic
959825627 3:110792657-110792679 CACCCAGCCCCACCACTGGTAGG + Intergenic
963999776 3:151756067-151756089 CACCCAGTCACCACAGTGGCTGG - Intronic
968116420 3:196093880-196093902 CACACAATCCCCTAAGTGGTAGG + Intergenic
972102004 4:35431774-35431796 CCTCCAGTCCCCAGAATGGTAGG + Intergenic
975617856 4:76265307-76265329 CACCCAGTCCCCTGCAAGGCTGG - Intronic
976136896 4:81947318-81947340 CTCCCTGTCCCCTTAATTGTAGG + Intronic
984950969 4:185007528-185007550 CACTTAGTCCTCCCAATGGTGGG - Intergenic
988283170 5:29175921-29175943 TTGCCAGTCCCCACAATGGTGGG + Intergenic
990796279 5:59544624-59544646 CACCTGGTTCCATCAATGGTTGG + Intronic
992223935 5:74600182-74600204 CACCCATTTCCCTTAAAGGTAGG + Intergenic
993019664 5:82576644-82576666 CTCCCACTCCCCTCCATGGGAGG - Intergenic
998486403 5:142506272-142506294 CACACAGTCCCCACCATGGAAGG - Intergenic
999454906 5:151707189-151707211 CACCCAGTACAGTAAATGGTAGG - Intergenic
1001531082 5:172462325-172462347 CACCCAAGCCGCTCAAAGGTTGG - Intergenic
1003135282 6:3430460-3430482 CACCCAGTCCCCAGTATTGTGGG + Intronic
1003968999 6:11280477-11280499 CACCCAGTCCTCCCCATGGTGGG - Intronic
1006929297 6:37678140-37678162 CCCCCAGTACCCCCAAGGGTTGG + Intronic
1007409944 6:41655788-41655810 CAGGCAGTCCTGTCAATGGTAGG - Intergenic
1007631530 6:43275738-43275760 CCCCCAGGGCCCTCAGTGGTGGG - Intronic
1008717903 6:54311292-54311314 CTCCCTGTTCCCTCCATGGTGGG + Intronic
1013873537 6:114796739-114796761 TGCCCAGGCCCCTCAAGGGTTGG - Intergenic
1017525741 6:155240127-155240149 CACCCAGTCCCCTCAATGGTTGG - Intronic
1019021115 6:168918467-168918489 CACCCTGTCCCATCCATCGTAGG - Intergenic
1019587951 7:1815029-1815051 CACCCAGACTCCTCAAAGGTGGG - Intergenic
1024614995 7:51104583-51104605 AAACCAGTGCCCTCACTGGTGGG + Intronic
1032034223 7:128509748-128509770 CAGCCAGTTCCCACAATGGCAGG + Intergenic
1037684686 8:21128910-21128932 CACCCAGTCCACTGAGTGGAAGG - Intergenic
1039983439 8:42428384-42428406 CCCCCAGTCCCCTCATTGGCTGG + Intronic
1056761533 9:89418993-89419015 CACCCAGGCCCCTCACTGGACGG + Intronic
1057214643 9:93221027-93221049 CACCCAATACCCTCCATCGTGGG - Intronic
1057997220 9:99829022-99829044 CACCCAGCCCCCTCACTGAAGGG + Intronic
1060172596 9:121474161-121474183 CACCCAGTCCTCTGAGGGGTGGG - Intergenic
1061488560 9:130933044-130933066 CACCCAAGCCCCTCCCTGGTGGG + Intronic
1190878155 X:54474465-54474487 CACCCTGTTCCCTCAGTGCTGGG - Intronic
1191210838 X:57883172-57883194 CCCTCAGGCCCCTCAATGGAGGG - Intergenic
1194720917 X:97339260-97339282 CACCCAGGCCTCTCAGTGCTGGG - Intronic