ID: 1017526419

View in Genome Browser
Species Human (GRCh38)
Location 6:155245115-155245137
Sequence CCACATGACCACGGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017526419_1017526426 -2 Left 1017526419 6:155245115-155245137 CCTTCTTCCCCGTGGTCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1017526426 6:155245136-155245158 GGATCTGGGATTAAGAGAATAGG No data
1017526419_1017526427 12 Left 1017526419 6:155245115-155245137 CCTTCTTCCCCGTGGTCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1017526427 6:155245150-155245172 GAGAATAGGTTTCTAATTGCTGG No data
1017526419_1017526428 13 Left 1017526419 6:155245115-155245137 CCTTCTTCCCCGTGGTCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1017526428 6:155245151-155245173 AGAATAGGTTTCTAATTGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017526419 Original CRISPR CCACATGACCACGGGGAAGA AGG (reversed) Intronic
901837797 1:11935336-11935358 CCTCATGACCATGGGAATGAGGG + Intronic
903489277 1:23715734-23715756 CCACATGACCACATGGATGATGG - Intergenic
904296047 1:29520504-29520526 CCGCATGACCAGGGGGAACTGGG - Intergenic
905915069 1:41678904-41678926 CCAGATGTCCAGGGAGAAGAAGG + Intronic
906253079 1:44326318-44326340 CCTCCTGGCCACAGGGAAGAGGG + Intronic
909584587 1:77275357-77275379 CCACATGAGCACTGGGGGGATGG + Intergenic
909737265 1:78978061-78978083 CCACATGACCAAGGTAAAGGAGG - Intronic
909940079 1:81601528-81601550 CCACAAGGACATGGGGAAGAGGG - Intronic
912232108 1:107806202-107806224 ACACAAGACAATGGGGAAGATGG + Intronic
912459117 1:109819464-109819486 CCACAGAGCCACAGGGAAGATGG - Intergenic
915524935 1:156469973-156469995 CCTCATGCCCAAGGGGCAGAGGG + Intronic
917522655 1:175760877-175760899 GCACAGGACCATGGGGATGAAGG + Intergenic
918914438 1:190616459-190616481 TCACATGACAATGGGGAAAATGG - Intergenic
922351474 1:224737652-224737674 CCACACAACAGCGGGGAAGACGG + Intronic
922721039 1:227900487-227900509 CCCCATGTCCACGGGGAGGGGGG + Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1062833813 10:623515-623537 ACACAAGGCCAAGGGGAAGAGGG + Intronic
1064197953 10:13260712-13260734 CCACAAGCCCACCGGGAGGAAGG + Intergenic
1068921822 10:62493028-62493050 CTTTTTGACCACGGGGAAGAAGG + Intronic
1070509754 10:77149863-77149885 CCACATGACCACTAAGCAGATGG - Intronic
1075586469 10:123662027-123662049 CCACCTGACCAGGGGCAACAAGG - Intergenic
1076280609 10:129243210-129243232 CCATATGAAAACGGGGAAGGTGG + Intergenic
1076747763 10:132522959-132522981 CCCCATGACTCCGGGGGAGAAGG + Intergenic
1078819163 11:14859132-14859154 CCACATGATCAAGATGAAGAAGG - Exonic
1079248396 11:18769944-18769966 CCACATGATCAAGTGGAAGAGGG - Intronic
1081903640 11:46651784-46651806 CCAGAAGACTACGGAGAAGACGG - Intronic
1083608628 11:63994199-63994221 CCATGTGACCACGGGCATGAGGG - Intronic
1085873480 11:80378832-80378854 ACACATGACAATGAGGAAGAGGG + Intergenic
1087111435 11:94473640-94473662 CCACATAACCACAGTGAAGGGGG + Intronic
1089074175 11:115724778-115724800 CAGCATGGCCAAGGGGAAGATGG - Intergenic
1094534938 12:31312972-31312994 CTACATATCCATGGGGAAGAGGG - Intronic
1097686977 12:62700251-62700273 CCACATGACCAGGGTGATGATGG - Intronic
1098850221 12:75587416-75587438 CCACATTGCCCAGGGGAAGATGG - Intergenic
1102721218 12:115018016-115018038 CAACATGAACAAGAGGAAGAAGG - Intergenic
1104161582 12:126186336-126186358 TCACAGGACAACGGGGCAGAGGG + Intergenic
1105046443 12:133007799-133007821 ACCCATGACCATGGGGAGGACGG - Intronic
1105448164 13:20475183-20475205 CCTCAGGAGCACCGGGAAGAGGG + Intronic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108455810 13:50612347-50612369 CCACATCACCACGTGGAAATAGG - Intronic
1112461355 13:99606444-99606466 CCCCATGACAGCGGGGACGAAGG + Intergenic
1112673787 13:101673565-101673587 CCAAATGACCATGGGGAATTAGG - Intronic
1117374530 14:55108463-55108485 CCACATGAACACTGGGGAGGAGG + Intergenic
1117481239 14:56147424-56147446 GCACATGTACATGGGGAAGAGGG + Intronic
1118058521 14:62108956-62108978 CAAAATGTTCACGGGGAAGAAGG - Exonic
1118302865 14:64630761-64630783 CCACATTAGCAGGTGGAAGAGGG + Intergenic
1118496621 14:66313925-66313947 ACACATGGCCACTGGGAACATGG + Intergenic
1118743517 14:68758124-68758146 CCTCATGAGCCAGGGGAAGAGGG + Intergenic
1118769212 14:68930507-68930529 CCCCATGACCAAGGGTATGAAGG - Intronic
1119647209 14:76356559-76356581 CCACATGGCCATGGGCCAGAAGG - Intronic
1120190772 14:81437255-81437277 CCACATGTTCACGGGGCATATGG - Intergenic
1122030266 14:98906915-98906937 CCAAATGACCACGGCGAAACAGG + Intergenic
1126425146 15:48519531-48519553 CCACAGGAGCACAAGGAAGAAGG + Intronic
1127712063 15:61609063-61609085 CCCCATGACCAAGGAGAACATGG + Intergenic
1129144064 15:73632440-73632462 CCAAATGAGCTGGGGGAAGAGGG - Intronic
1129798377 15:78395254-78395276 CAACATTAACAAGGGGAAGATGG + Intergenic
1138079475 16:54075987-54076009 CCACCTGAGCTAGGGGAAGATGG - Intronic
1139962818 16:70727754-70727776 CCACAGGAGCATGGGGAGGATGG + Intronic
1141137391 16:81475018-81475040 CCACAAGGCCACGGTGAAGAGGG - Intronic
1141812458 16:86384688-86384710 CCACAAGACCGCTGGGAAGATGG - Intergenic
1141901448 16:86993745-86993767 CCACATCACCGCAGGGAAGTGGG + Intergenic
1143965017 17:10750902-10750924 CCAAATGACCCTGGGGAGGAGGG + Intergenic
1145207311 17:20991441-20991463 CCCCATGCTCACGGGGAGGAAGG + Intergenic
1146646293 17:34579449-34579471 CCACGTGACCACGGGGAATCTGG + Intergenic
1148019752 17:44545756-44545778 CCACATGAACACTGAGAAGGTGG + Intergenic
1149013804 17:51885282-51885304 CCTCATGACCAAGAGGACGAAGG + Intronic
1149084079 17:52693351-52693373 GAACATAACCCCGGGGAAGAAGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150712840 17:67546451-67546473 CTACAGGAGCACAGGGAAGAGGG - Intronic
1152335352 17:79697451-79697473 CCCCCTGGCCACGGTGAAGAGGG + Intergenic
1157316441 18:46593811-46593833 TCATATTACCATGGGGAAGAAGG + Intronic
1159887630 18:73924199-73924221 CCTCATGGCCTGGGGGAAGAGGG - Intergenic
1160148023 18:76379786-76379808 CCACAGGACCTCGGGGTAGTAGG + Exonic
1161566516 19:5005751-5005773 CTACAGGGCCACGGGGGAGAAGG + Intronic
1163700625 19:18784968-18784990 CCACATGACCACGTAGAAGCTGG + Exonic
1165948137 19:39457760-39457782 CCACAAGACTACTGGGAAGAGGG + Intronic
1166267590 19:41694888-41694910 TCACATGGCCCCGGGGATGAAGG - Intronic
925371806 2:3351083-3351105 TCACTTGACAACTGGGAAGATGG - Intronic
926962835 2:18377806-18377828 CCAAATGACCTCAGGAAAGAAGG - Intergenic
927514068 2:23661707-23661729 CCCCAGGCCCACTGGGAAGAGGG + Intronic
928687840 2:33767790-33767812 CCACTAGACCACATGGAAGAGGG - Intergenic
929895112 2:45953139-45953161 CCACCTGGCCATGGGGAAGGGGG - Intronic
931888577 2:66644967-66644989 CCACTTGACCATGGTGAAAAAGG + Intergenic
933336607 2:80967230-80967252 CCTCATGATCTCAGGGAAGAAGG - Intergenic
940259619 2:151766334-151766356 CCACATGACCAGGGAGCAGTGGG + Intergenic
940890600 2:159032022-159032044 CCATATGACCTTAGGGAAGAAGG - Intronic
944440884 2:199742279-199742301 CCACAGGGCCAGGGGAAAGAAGG - Intergenic
946053030 2:216880014-216880036 CCACAGGACCAAAGGAAAGATGG - Intergenic
946876830 2:224137962-224137984 CCTCATGACCAGGGAGAAGGGGG - Intergenic
1169151307 20:3291744-3291766 CCACATCAGCACAGAGAAGACGG + Intronic
1170577918 20:17678566-17678588 CCACATGATCAAGAGGAACAGGG + Intronic
1170718401 20:18852248-18852270 CCACAGGAGCTTGGGGAAGATGG + Intergenic
1172547992 20:35776620-35776642 CAACAGGATCACGTGGAAGAGGG - Intronic
1178439162 21:32584418-32584440 GCACATGACCCAGGGGGAGAAGG - Intronic
1178797472 21:35758122-35758144 CCCCATGACCCTGGGGAAGGAGG - Intronic
1179608618 21:42534338-42534360 CCACCTGTCCACAAGGAAGAAGG - Intronic
1184048223 22:41985725-41985747 CCACAGGACCACTGGGAAAAGGG - Intronic
1185053152 22:48564150-48564172 ACACATGACCACTGTGAAAACGG + Intronic
1185418623 22:50722857-50722879 CCACATGGCCACAGAGAGGATGG - Intergenic
950123816 3:10499326-10499348 TCACGTGACAACCGGGAAGATGG + Intronic
952298502 3:32083366-32083388 GCACCTGTCCATGGGGAAGAAGG + Intergenic
952307171 3:32156528-32156550 CCACATCACCCCGTGGGAGAGGG + Intronic
954002045 3:47565551-47565573 CCACATGACCCCTGGGTTGAAGG - Intronic
956512573 3:70010503-70010525 CCATAGCACCAAGGGGAAGATGG + Intergenic
958260594 3:91376121-91376143 CCACATGAGCAAGGTAAAGAGGG + Intergenic
958762840 3:98329064-98329086 CCCCAGGCCCACGGGGAAGCAGG - Intergenic
960945311 3:122962338-122962360 CCACATGGTCTCAGGGAAGAAGG + Intronic
961353848 3:126321587-126321609 CCTCATGACCTCTGTGAAGATGG + Intergenic
961530605 3:127537674-127537696 CCGCATGACCACAGGAACGATGG - Intergenic
961658738 3:128457262-128457284 CCCCATGACAACGGGGCAGATGG + Intergenic
963741662 3:149087196-149087218 CCAAGTGCCCACGGGGAAAATGG - Intergenic
964001862 3:151784311-151784333 ACACATAACCACAGTGAAGATGG + Intergenic
964088988 3:152850884-152850906 CCACTTGACCTCTGGGAACATGG - Intergenic
965288205 3:166843828-166843850 CCACAAGCCCACCGGGAGGAAGG + Intergenic
967555362 3:190850463-190850485 CCACCTGTGCACTGGGAAGATGG + Intergenic
967853694 3:194100794-194100816 ACACATCACCCAGGGGAAGAAGG + Intergenic
967998287 3:195183363-195183385 CCTCCTGACCCCTGGGAAGAAGG + Intronic
969878672 4:10155457-10155479 CCAGAACACCACGAGGAAGAGGG - Intergenic
969991005 4:11262063-11262085 CCCAATTACCAAGGGGAAGACGG + Intergenic
970584020 4:17497967-17497989 CCACATGCCTGCGGGGCAGAGGG - Intronic
971144426 4:23961641-23961663 CCCAATTACCACAGGGAAGAGGG - Intergenic
971144445 4:23961721-23961743 CCCAATTACCACAGGGAAGAGGG - Intergenic
974445072 4:61969879-61969901 CCACAGGACCACGTAGAAAATGG - Intronic
980116679 4:128686135-128686157 CCACATGCCCACTAGGAGGATGG - Intergenic
986334480 5:6743223-6743245 CCAGATGACAAGGGGGAAGGGGG - Intronic
992774686 5:80079164-80079186 CCACATGACCACGTAGAAGCTGG - Exonic
999094704 5:148967611-148967633 CCATATCACCACTGGGAAAATGG - Intronic
1000304553 5:159983568-159983590 CCACATTCCCACGGCTAAGACGG - Intergenic
1001815292 5:174663689-174663711 GCACATGACCACTGGAAAGGGGG - Intergenic
1003216616 6:4119086-4119108 CCATATTACCAAGGGAAAGAAGG + Intronic
1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG + Intronic
1008994622 6:57644259-57644281 CCACATGAGCAAGGTAAAGAGGG - Intronic
1009183165 6:60543082-60543104 CCACATGAGCAAGGTAAAGAGGG - Intergenic
1017526419 6:155245115-155245137 CCACATGACCACGGGGAAGAAGG - Intronic
1018683869 6:166286820-166286842 CCACCTGACAATGAGGAAGAAGG - Intergenic
1025782606 7:64615224-64615246 GCACCTGCCCACAGGGAAGATGG + Intergenic
1027373252 7:77529758-77529780 CCATATGGCCATGGGGGAGATGG - Intergenic
1027869655 7:83691118-83691140 TCACAGGACCAAGGGGAAGAGGG + Intergenic
1036518068 8:9463965-9463987 CCACATAACCACAGGGATGCTGG - Intergenic
1041441826 8:57905181-57905203 CATCATAACCAAGGGGAAGAAGG + Intergenic
1045232178 8:100316185-100316207 CCACAAGCCCACTGGGAGGAAGG - Intronic
1045365338 8:101470621-101470643 CCACATCAAGACTGGGAAGAGGG - Intergenic
1050561010 9:6834540-6834562 CCACACGATGAAGGGGAAGACGG - Intronic
1057445415 9:95111196-95111218 TCAAATGACCTTGGGGAAGAAGG + Intronic
1058436809 9:104970646-104970668 CCAGATGACCACCTAGAAGAGGG - Intergenic
1058935617 9:109767178-109767200 ACACATGAGCAAGGGGAACATGG - Intronic
1059751242 9:117249613-117249635 CCTCAAGACCAGGGGGAAGGTGG - Intronic
1061856373 9:133443886-133443908 CCACGTGGGCACGGGGGAGATGG - Intronic
1062023444 9:134329782-134329804 CCACACAGCCACGGGGGAGATGG - Intronic
1062114685 9:134802048-134802070 TCACTTGCCCACAGGGAAGAGGG + Intronic
1062343697 9:136105066-136105088 CCACAGGACCACAGAGACGAGGG - Intergenic
1186486365 X:9937152-9937174 CAACAACACCACGGTGAAGATGG + Exonic
1186598719 X:11012604-11012626 CCAAAAGACCATGTGGAAGATGG + Intergenic
1186879210 X:13848115-13848137 GGACATGACCATGGGCAAGACGG - Intronic
1190891184 X:54569646-54569668 CCAGATGATCAAGGGGAAAAAGG - Intergenic
1198586619 X:138128860-138128882 CCCCAGTACCACAGGGAAGACGG + Intergenic
1201677676 Y:16605185-16605207 CCACCTCACTACAGGGAAGAGGG - Intergenic