ID: 1017526641

View in Genome Browser
Species Human (GRCh38)
Location 6:155246989-155247011
Sequence ATTCCTACACACACCCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017526633_1017526641 25 Left 1017526633 6:155246941-155246963 CCAAGTAGCACTGGTGTATCCGC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1017526641 6:155246989-155247011 ATTCCTACACACACCCTTCATGG 0: 1
1: 0
2: 1
3: 11
4: 164
1017526638_1017526641 -4 Left 1017526638 6:155246970-155246992 CCAAACCAAATGCACCTGGATTC 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1017526641 6:155246989-155247011 ATTCCTACACACACCCTTCATGG 0: 1
1: 0
2: 1
3: 11
4: 164
1017526637_1017526641 -3 Left 1017526637 6:155246969-155246991 CCCAAACCAAATGCACCTGGATT 0: 1
1: 0
2: 2
3: 19
4: 179
Right 1017526641 6:155246989-155247011 ATTCCTACACACACCCTTCATGG 0: 1
1: 0
2: 1
3: 11
4: 164
1017526635_1017526641 6 Left 1017526635 6:155246960-155246982 CCGCTGGTACCCAAACCAAATGC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1017526641 6:155246989-155247011 ATTCCTACACACACCCTTCATGG 0: 1
1: 0
2: 1
3: 11
4: 164
1017526639_1017526641 -9 Left 1017526639 6:155246975-155246997 CCAAATGCACCTGGATTCCTACA 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1017526641 6:155246989-155247011 ATTCCTACACACACCCTTCATGG 0: 1
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017526641 Original CRISPR ATTCCTACACACACCCTTCA TGG Intronic
903058465 1:20653199-20653221 ATTCCTTCACACAGTATTCATGG + Intronic
903766020 1:25734745-25734767 AAGCCTACACAGACCCTGCAGGG - Intronic
904201583 1:28823149-28823171 CTTTCTGCACACACCCTTCCTGG - Intronic
905540185 1:38754597-38754619 GTTCATAGATACACCCTTCAAGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
911138594 1:94471091-94471113 CCCCCTACAAACACCCTTCAAGG - Intronic
911521335 1:98933911-98933933 ATTCCTTCACCCAGCTTTCAAGG - Intronic
915620411 1:157079348-157079370 TCTCCAACACACACCCTCCAGGG - Intergenic
917538423 1:175891260-175891282 ATTCCTCCTCACACTCCTCAGGG + Intergenic
918150218 1:181791852-181791874 ATTCCATCACACATCATTCAGGG - Intronic
918359487 1:183741182-183741204 ATTCCTTCACACAGCATCCAAGG - Intronic
918869170 1:189945574-189945596 ATTCTAATACACACCCTTAAAGG + Intergenic
919388072 1:196946112-196946134 AGTCCTACACACCCTATTCATGG - Intronic
920654297 1:207864243-207864265 ATTCCTGCAGCCAACCTTCATGG - Intergenic
920987600 1:210905091-210905113 ATCCCTACAGTCACCTTTCAGGG - Intronic
923603474 1:235423291-235423313 CCTCCCACACACACCGTTCAAGG - Intronic
1065822423 10:29538254-29538276 ATTCTTACACAAGCCCTTGATGG - Intronic
1066222010 10:33344510-33344532 CTTCCTCCACAGCCCCTTCAGGG - Intergenic
1066616282 10:37298161-37298183 ATTTATACACACACCCTTATGGG - Intronic
1068227376 10:54123472-54123494 ATACCTACTCACACCAGTCAGGG + Intronic
1068834697 10:61541304-61541326 ATCCCTACACGAACCCTTGATGG + Intergenic
1072565729 10:96615248-96615270 ATTCCTGCTCACAGCCTACAAGG - Intronic
1074430090 10:113386976-113386998 AGTCCTGCACTCACCCTTAATGG - Intergenic
1077673849 11:4180884-4180906 ATTCCTCCAGACAAGCTTCAGGG + Intergenic
1078476385 11:11633679-11633701 ATTCCCACTCACACCCTGAAGGG + Intergenic
1081701783 11:45157009-45157031 ATTCCTTCACACAGCATTCAAGG - Intronic
1081749006 11:45494513-45494535 TTCCCTACAAACTCCCTTCATGG - Intergenic
1088571369 11:111227199-111227221 CTTCCTCCACCCACTCTTCAAGG + Intergenic
1093555203 12:20464705-20464727 AGTCCTGCACTCACTCTTCAAGG - Intronic
1095197507 12:39338575-39338597 AGTCCTGCAAACTCCCTTCATGG + Intronic
1096849568 12:54426985-54427007 ATTCCTGCCCACCCACTTCAGGG - Intergenic
1100356884 12:93839290-93839312 ATTCCTACACAGATCCATGAGGG - Intronic
1100457028 12:94762451-94762473 AGTCCTATAAACTCCCTTCATGG + Intergenic
1100494860 12:95114991-95115013 AATTCTACTCACACTCTTCAAGG + Intronic
1101989373 12:109471972-109471994 AGGCCTACACACTCCATTCATGG - Intronic
1102032935 12:109753413-109753435 ATACATACACACCCCCATCAGGG - Intronic
1105661281 13:22498298-22498320 ATGCCTCCACACACTTTTCATGG + Intergenic
1106487316 13:30183360-30183382 AGTCCTACAGACCCCATTCACGG - Intergenic
1106656202 13:31749461-31749483 ATTCCTACACACATACTCCTGGG + Intronic
1110335176 13:74321718-74321740 ATTCATACACACACACATGAGGG + Intergenic
1111954805 13:94744518-94744540 AGTCCTCCACACATCCTTTAAGG + Intergenic
1112921946 13:104624950-104624972 ATTCCTACACATACATCTCATGG + Intergenic
1113299775 13:109005951-109005973 ATTACTAGCCACACCCTTAAGGG + Intronic
1117574593 14:57085435-57085457 ATCCCTCCACACACCCATAATGG + Intergenic
1118077495 14:62316480-62316502 TTACCATCACACACCCTTCAAGG - Intergenic
1119347338 14:73937146-73937168 ATGCCCACAAACACCCTGCAAGG - Intronic
1127159955 15:56171980-56172002 GTTCCTTCTCACACCCTTCAAGG - Intronic
1129118623 15:73381073-73381095 TTTCCAACACACAAACTTCAGGG + Intergenic
1131523348 15:93133540-93133562 GTGCCTACCCCCACCCTTCATGG + Intergenic
1134220648 16:12351140-12351162 ATTCCTACAATCCCCCTGCAGGG - Intronic
1135384218 16:22021943-22021965 ATTCTTACAACCACCCTTCAAGG - Intronic
1137798643 16:51242642-51242664 ATACCCACACACACCCTAAAGGG - Intergenic
1137825589 16:51491831-51491853 ATGCCCCCACACACCCCTCAAGG + Intergenic
1138621021 16:58211444-58211466 ATGCCAACCCACACCCTGCAGGG - Intergenic
1139934815 16:70561898-70561920 ATTGCAACACACAAGCTTCATGG - Intronic
1140542875 16:75775432-75775454 AGTCCAACACACTCCCTTGATGG - Intergenic
1141702453 16:85648717-85648739 ACTCCTCCAGACACCATTCACGG - Exonic
1143651412 17:8266136-8266158 ATTCTGACACACACTCTTGATGG + Intronic
1147496067 17:40916999-40917021 ATTTCTAAGCATACCCTTCATGG - Intergenic
1148731408 17:49839060-49839082 ATTCCTGCCCACACCATGCATGG + Intronic
1151133133 17:71919069-71919091 CTTCCTGCACCCACCTTTCATGG + Intergenic
1156287867 18:35716494-35716516 ATTTCTACACATGCCCTTCTTGG - Intergenic
1157927608 18:51783323-51783345 ATTCTTCCACGAACCCTTCAGGG - Intergenic
1158452959 18:57583121-57583143 GTTAATACACTCACCCTTCAAGG + Intronic
1158752548 18:60280238-60280260 ATGCCTGCACGCTCCCTTCAAGG - Intergenic
1158911055 18:62062945-62062967 ATTCCTTTACACAGCCCTCATGG - Intronic
1160140323 18:76315801-76315823 ATTCCAACACTCACAATTCAGGG - Intergenic
1160755092 19:752818-752840 ATTCCTACACCCGCCCTCCCCGG + Intronic
1161809938 19:6465792-6465814 ATTCCTGCCCACTCCCTCCAGGG - Intronic
1162764635 19:12911359-12911381 ATTCCTTCACACAGCATACAAGG + Intronic
926741653 2:16116252-16116274 ATTTCTCCACACAGCCTCCAGGG - Intergenic
927513343 2:23658157-23658179 CACCCTACTCACACCCTTCAAGG + Intronic
929225860 2:39511207-39511229 ATGCCCACACCCACCTTTCATGG + Intergenic
929800227 2:45093395-45093417 ATGCCTTCACACATCCTGCAAGG - Intergenic
930652969 2:53980708-53980730 AGTCCTACAGACTCCATTCATGG + Intronic
931308693 2:61057765-61057787 ATCCTTACACACAACCTTCAAGG - Intergenic
931580809 2:63771483-63771505 AATCTTACACAAACTCTTCAAGG + Intronic
934128048 2:88917568-88917590 ACTACTACACACAACCTGCAAGG + Intergenic
938921259 2:135997389-135997411 ATTCCTACATTCACAGTTCAGGG + Intergenic
940400401 2:153242279-153242301 CTTCCCACCCACACCCATCATGG + Intergenic
940839810 2:158567308-158567330 CTTCCTATACACACCACTCAAGG - Intronic
941649410 2:168077779-168077801 ATCCCTACAAACTCCCTACAAGG - Intronic
943261300 2:185666632-185666654 ATTCCTGCAAGCTCCCTTCATGG - Intergenic
947492906 2:230611226-230611248 TTCTCCACACACACCCTTCAAGG + Intergenic
948057580 2:235020123-235020145 ATTCCTACAAACCTGCTTCAGGG - Intronic
1170876132 20:20251891-20251913 ATTCATAAAAGCACCCTTCAGGG + Intronic
1171185747 20:23122884-23122906 CCTCCTCCACACACCCTTCAAGG + Intergenic
1172157350 20:32837253-32837275 AGACCTACACACTTCCTTCAAGG - Intronic
1172828072 20:37807221-37807243 ACTCTTGCAAACACCCTTCATGG - Intronic
1173687340 20:44932871-44932893 ATTCCTACACTCCCCCTTTCTGG + Intronic
1175767789 20:61603256-61603278 ATTCCTGCAAACACTCTCCACGG - Intronic
1176390598 21:6161146-6161168 TTTCCTCCCCCCACCCTTCAAGG - Intergenic
1177171406 21:17659972-17659994 ATTCTTACATAGATCCTTCAAGG + Intergenic
1179732869 21:43377093-43377115 TTTCCTCCCCCCACCCTTCAAGG + Intergenic
1180888518 22:19267421-19267443 ATTCCTACAAAAATCCTTCTGGG - Intronic
1182387865 22:29961774-29961796 AGTCCTACAAGCACCATTCATGG + Intronic
1184326349 22:43790241-43790263 AATCCCACACACATCCTTCTTGG + Intronic
1184659119 22:45957803-45957825 CTTCCTGCACACACGCTCCATGG + Intronic
952232432 3:31445793-31445815 TTTCCCACACACAGTCTTCATGG - Intergenic
953070510 3:39515142-39515164 ATGCTGACACACCCCCTTCAGGG + Exonic
954557892 3:51532663-51532685 AGTTCTCCACACACCCTACAGGG - Intergenic
955032761 3:55237050-55237072 GCTCCTGCACACACCCTTCATGG - Intergenic
955133640 3:56194518-56194540 AGTCCTACAAACTCCATTCATGG - Intronic
961642132 3:128371379-128371401 ATACCCACAAACACCCTGCAGGG - Intronic
963421798 3:145070210-145070232 AACCCTAGACAGACCCTTCAAGG + Intergenic
966894065 3:184429142-184429164 ATTCAGACAAACATCCTTCAAGG - Intronic
968278644 3:197459331-197459353 ATCCCTACTCACAGCCTCCAAGG - Intergenic
970381158 4:15509157-15509179 AGTCCAACACACATCCTCCAGGG - Intronic
973213423 4:47641729-47641751 TTTCCAGCACACACTCTTCAGGG + Intronic
973950008 4:56002779-56002801 ATTCCTGCTCAAACTCTTCAAGG - Intronic
975663760 4:76713037-76713059 ATTCCTGCAGGCTCCCTTCATGG - Intronic
976546595 4:86342969-86342991 ATTCCTTCACAGATCATTCAGGG + Intronic
977022587 4:91775285-91775307 ATTGCTGAACACAGCCTTCAAGG - Intergenic
977022852 4:91777335-91777357 ATTGCTGGACACACCCTTCAAGG - Intergenic
980232673 4:130064606-130064628 AATACTACACACACCATTCCTGG + Intergenic
981936614 4:150246494-150246516 ATTTCTTCACCCAGCCTTCAGGG - Intronic
982207498 4:153007758-153007780 ATTCCTACAAACACTATTCTTGG - Intergenic
982776883 4:159451223-159451245 AGTCCTACACATGCCATTCATGG + Intergenic
984052317 4:174879886-174879908 ATTCCAATACACACTCTTAAAGG - Intronic
985420965 4:189784969-189784991 ATCCCTAGACACACCTTACAAGG + Intergenic
986951397 5:13089984-13090006 ATTCATAAACAACCCCTTCAGGG + Intergenic
987134625 5:14889331-14889353 ATTCCTTCCCACGGCCTTCAGGG - Intergenic
988678148 5:33455580-33455602 ATTGCTAGACACACCCCTGAAGG - Exonic
988714043 5:33807044-33807066 ATTCCTACACACAGCGTACAAGG + Intronic
992348335 5:75903324-75903346 ACTCCTACACACAACACTCAAGG - Intergenic
994018813 5:95000871-95000893 AATCCTACAAGCACCATTCATGG + Intronic
994171565 5:96663197-96663219 CTTCCAACACACTCCCTTCCGGG - Intronic
994217559 5:97155486-97155508 ATTCCTAGACACAACCTCCCAGG - Intronic
995382977 5:111555553-111555575 ATACCACCACACACCCTTTAGGG - Intergenic
995675161 5:114654895-114654917 ACCCCAACAAACACCCTTCAGGG - Intergenic
997468149 5:134101903-134101925 ATTCCAAGAGACACCCTTCTAGG + Intergenic
998031179 5:138869579-138869601 CTTCCTACACACAGCTATCAGGG - Exonic
999898488 5:156061380-156061402 ATTCCTATAGGCTCCCTTCATGG + Intronic
1001548361 5:172584546-172584568 ATTCCTCGACACAGCATTCACGG - Intergenic
1005730477 6:28692414-28692436 TTTACTACACAGACCCTTTATGG - Intergenic
1006478670 6:34274249-34274271 CTTCCTACCCACAGCTTTCAGGG - Intergenic
1006976139 6:38103543-38103565 ATACATACATACACACTTCACGG + Intronic
1009738636 6:67713944-67713966 ATTCTTACACTTACCCTTTATGG + Intergenic
1012930018 6:105306838-105306860 AATCCTACACAGGCCCTTAAGGG + Intronic
1017526641 6:155246989-155247011 ATTCCTACACACACCCTTCATGG + Intronic
1019075581 6:169384868-169384890 ATTACCACACATACCCTCCAGGG + Intergenic
1019123592 6:169824637-169824659 ATTCCTGAACACAACCTTCCTGG - Intergenic
1019363667 7:619238-619260 ATCCCCACACACAGCCCTCAGGG + Intronic
1021075030 7:16292504-16292526 ATTCCTTAATGCACCCTTCAGGG - Intronic
1022006718 7:26272282-26272304 AATGCCACACACACCCTACAAGG + Intergenic
1022487687 7:30792421-30792443 AATCTTACACTCACTCTTCAAGG - Intronic
1022971147 7:35518502-35518524 ATTCCTGCACTCACACTTCCTGG - Intergenic
1024386598 7:48759079-48759101 ACACACACACACACCCTTCAGGG + Intergenic
1025622525 7:63186931-63186953 ATTGCTGCACTCAACCTTCAGGG - Intergenic
1029327755 7:99824298-99824320 ATTCATTCACACACCCCTCATGG + Intergenic
1032680426 7:134176848-134176870 ATTCCCACACACACCCTCACAGG - Intronic
1032982366 7:137299059-137299081 ATTCCTACACACTTCCTCTATGG + Intronic
1036559506 8:9889638-9889660 ATACCACCACACACCCTTTAAGG + Intergenic
1044001554 8:86888148-86888170 CTTCCTTCACTCATCCTTCATGG + Intronic
1048085787 8:131177743-131177765 AGTCCTGCACACTCCATTCATGG - Intergenic
1048946735 8:139455671-139455693 TATCCTAAACACAGCCTTCATGG - Intergenic
1049031402 8:140040709-140040731 ATCCCAACACACATCATTCAGGG + Intronic
1049689133 8:143951116-143951138 GTTTCTAAACACATCCTTCAAGG + Intronic
1050241339 9:3638848-3638870 ATTCCTCCTCATACCCTACAAGG + Intergenic
1050867136 9:10516182-10516204 ATTCCTACTAACAGCGTTCAAGG + Intronic
1051752952 9:20363311-20363333 ATGCCTACACACACTTTACAGGG - Intronic
1051877350 9:21806424-21806446 AATCCTACACTCACCCTCCTTGG - Intronic
1054919989 9:70533276-70533298 ATTCCTCTATAGACCCTTCAGGG + Exonic
1056211961 9:84373223-84373245 ATTCCTACCCACAGCCTTCTTGG + Intergenic
1057166244 9:92928740-92928762 AGTCCTACACAGAACCTTGATGG - Intergenic
1059602021 9:115789074-115789096 ACTCATACAGACACTCTTCAGGG + Intergenic
1060613286 9:124988075-124988097 ACACATACACACACGCTTCAGGG + Intronic
1060954817 9:127631099-127631121 CTGCCTCCACACACTCTTCATGG - Intronic
1061307893 9:129742952-129742974 TTTCCTTCACCCACTCTTCAGGG - Intronic
1186181574 X:6978087-6978109 AATCCTACACACACTGTTTAAGG - Intergenic
1188653206 X:32657460-32657482 ATTCTTACAAACACCCTAAAAGG + Intronic
1190708792 X:53050568-53050590 ATCCCTACACACACCCATCAGGG - Intronic
1190973735 X:55379230-55379252 ATTCCTACACCAAACCTTCTGGG - Intergenic
1191085148 X:56558660-56558682 ATTAATACACATACCCTTCAGGG - Intergenic
1192142746 X:68659554-68659576 CTTCCTACACTCACCCTTATAGG + Intronic
1192860205 X:75059841-75059863 ATACCTGCACATACCCTTGATGG - Intronic
1201582849 Y:15528971-15528993 ATTCCTGGACACAACCTCCAAGG - Intergenic