ID: 1017533820

View in Genome Browser
Species Human (GRCh38)
Location 6:155325995-155326017
Sequence CTGCTTGTATACAGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017533815_1017533820 13 Left 1017533815 6:155325959-155325981 CCCTGACATTTCAACTTCTCATG No data
Right 1017533820 6:155325995-155326017 CTGCTTGTATACAGGGAGAAAGG No data
1017533816_1017533820 12 Left 1017533816 6:155325960-155325982 CCTGACATTTCAACTTCTCATGC No data
Right 1017533820 6:155325995-155326017 CTGCTTGTATACAGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017533820 Original CRISPR CTGCTTGTATACAGGGAGAA AGG Intergenic
No off target data available for this crispr