ID: 1017534449

View in Genome Browser
Species Human (GRCh38)
Location 6:155331247-155331269
Sequence ACTTGCTATCTCTGTGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017534442_1017534449 27 Left 1017534442 6:155331197-155331219 CCTACGTTGAGCTCTGGCTCAAA No data
Right 1017534449 6:155331247-155331269 ACTTGCTATCTCTGTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017534449 Original CRISPR ACTTGCTATCTCTGTGATGT GGG Intergenic
No off target data available for this crispr