ID: 1017536025

View in Genome Browser
Species Human (GRCh38)
Location 6:155348959-155348981
Sequence ACTTTTGCATAGGGCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017536019_1017536025 23 Left 1017536019 6:155348913-155348935 CCTAGTAAGGAGATATGGGAAGA No data
Right 1017536025 6:155348959-155348981 ACTTTTGCATAGGGCTGCTGTGG No data
1017536017_1017536025 27 Left 1017536017 6:155348909-155348931 CCTGCCTAGTAAGGAGATATGGG No data
Right 1017536025 6:155348959-155348981 ACTTTTGCATAGGGCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017536025 Original CRISPR ACTTTTGCATAGGGCTGCTG TGG Intergenic
No off target data available for this crispr