ID: 1017540548

View in Genome Browser
Species Human (GRCh38)
Location 6:155398004-155398026
Sequence CAGGGTTTCAAAGTTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017540543_1017540548 15 Left 1017540543 6:155397966-155397988 CCTTGCAACTTAGCCTACATATA 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1017540548 6:155398004-155398026 CAGGGTTTCAAAGTTGTTTCTGG No data
1017540544_1017540548 2 Left 1017540544 6:155397979-155398001 CCTACATATAAACACCACATCTG 0: 1
1: 0
2: 1
3: 20
4: 296
Right 1017540548 6:155398004-155398026 CAGGGTTTCAAAGTTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017540548 Original CRISPR CAGGGTTTCAAAGTTGTTTC TGG Intronic
No off target data available for this crispr