ID: 1017540915

View in Genome Browser
Species Human (GRCh38)
Location 6:155401667-155401689
Sequence GTGTCAACTTACCATATGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017540915_1017540916 -6 Left 1017540915 6:155401667-155401689 CCAATCATATGGTAAGTTGACAC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1017540916 6:155401684-155401706 TGACACCTTTCTTCATCGTTAGG No data
1017540915_1017540917 -2 Left 1017540915 6:155401667-155401689 CCAATCATATGGTAAGTTGACAC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1017540917 6:155401688-155401710 ACCTTTCTTCATCGTTAGGTTGG No data
1017540915_1017540920 20 Left 1017540915 6:155401667-155401689 CCAATCATATGGTAAGTTGACAC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1017540920 6:155401710-155401732 GGTTAAACTGTTCTAACAAATGG 0: 1
1: 0
2: 0
3: 16
4: 173
1017540915_1017540919 -1 Left 1017540915 6:155401667-155401689 CCAATCATATGGTAAGTTGACAC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1017540919 6:155401689-155401711 CCTTTCTTCATCGTTAGGTTGGG 0: 1
1: 0
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017540915 Original CRISPR GTGTCAACTTACCATATGAT TGG (reversed) Intronic
900870395 1:5298078-5298100 GTGTCATCCTACCATGTGACTGG - Intergenic
913548623 1:119895034-119895056 GTTGCAACTTACAATTTGATTGG + Exonic
917272661 1:173295520-173295542 GAGCCAACTTTCCATTTGATGGG - Intergenic
1064335384 10:14436006-14436028 CTGTCAACTTATCCTTTGATGGG + Intronic
1065479829 10:26181714-26181736 CTGCCATCTTACCATATGTTTGG - Intronic
1067483607 10:46623997-46624019 GTGTAAATTTACAAAATGATAGG - Intergenic
1067611148 10:47717645-47717667 GTGTAAATTTACAAAATGATAGG + Intergenic
1071626567 10:87177883-87177905 GTGTAAATTTACAAAATGATAGG + Intronic
1082610121 11:55285351-55285373 GTGTCCACTTACCACTTGAGTGG - Intergenic
1082901173 11:58254496-58254518 GTGTCAATTAACATTATGATAGG - Intergenic
1086114800 11:83237563-83237585 ATGGCAACTTAGCAAATGATTGG - Intronic
1088018576 11:105090777-105090799 CTGTCATCTTACCCTTTGATTGG + Intronic
1090528771 11:127566854-127566876 GTTTCAAGTTACCATATTAAAGG - Intergenic
1099894486 12:88627605-88627627 TTTTCAACTTATAATATGATGGG + Intergenic
1100420429 12:94427003-94427025 GTTACAAATTACCATATAATAGG - Intronic
1103884354 12:124189633-124189655 GTAGCAAATTACCATAGGATGGG + Intronic
1111718580 13:91912668-91912690 CTGTAATCTTTCCATATGATAGG - Intronic
1124528432 15:30479921-30479943 GTTTCAAAATACCATATTATAGG + Intergenic
1124770225 15:32527777-32527799 GTTTCAAAATACCATATTATAGG - Intergenic
1127706841 15:61555840-61555862 GTGCCAAATTACCAAATTATAGG - Intergenic
1131302583 15:91212457-91212479 CTGTCAAGTTACCTAATGATGGG - Intronic
1131417426 15:92272781-92272803 GTGTCAACATACCAAAGGACAGG + Intergenic
1134259611 16:12640454-12640476 GTGAGAACTTACCATAAAATGGG - Intergenic
1137913225 16:52400230-52400252 ATATCCACTTACCATATGGTAGG + Intergenic
1138749597 16:59402613-59402635 GCCTCAACTCACAATATGATGGG - Intergenic
1138830043 16:60364301-60364323 GTCTCAACTTAAAAAATGATAGG - Intergenic
1139073521 16:63414449-63414471 ATTTCAACTTACCATAAGACTGG + Intergenic
1146010045 17:29186643-29186665 GTGGTAACTTACCACATGATAGG - Intergenic
1149226349 17:54475935-54475957 GTGTAAATTTAAAATATGATAGG - Intergenic
1150715928 17:67572557-67572579 GTGTGAGCTTACCACATGGTTGG + Intronic
1159171937 18:64781884-64781906 GTGTCATCATAAAATATGATAGG + Intergenic
934924551 2:98372917-98372939 CTGTCAATTTACCATGTGAAGGG - Intronic
942264532 2:174208569-174208591 ATATCAATTTACCATGTGATGGG + Intronic
1177441243 21:21128373-21128395 CTTTCAACTTAGCATCTGATAGG + Intronic
1181892546 22:26076380-26076402 GTGAGCACTTACTATATGATGGG - Intergenic
955541257 3:59978915-59978937 GTGTCAAGTTTCCAAATTATGGG + Intronic
955825550 3:62943016-62943038 TTGTCAAATTACCATATCAGTGG - Intergenic
956469948 3:69555908-69555930 CTCTCAACTTACCAAATGAATGG + Intergenic
966619864 3:181952310-181952332 CTGACATCTTACCATGTGATTGG + Intergenic
972036654 4:34531280-34531302 GAGTCAAATTACCATAGCATTGG - Intergenic
978411549 4:108431426-108431448 GTGGGAACTTAACATATAATGGG - Intergenic
982447913 4:155515669-155515691 GTTTCAACATACCATATGCAAGG + Intergenic
983405459 4:167323859-167323881 GTGCCATCTTACCATATCAAGGG + Intergenic
988671127 5:33383060-33383082 GTGTCAAGGTACCATATTTTGGG - Intergenic
991325852 5:65431501-65431523 GTGTAAACTAACCATAAGACAGG + Intronic
998180988 5:139941843-139941865 GTTTCAACTTCCCATAGCATGGG + Intronic
1005284132 6:24306222-24306244 ATGATAACTTACCATTTGATTGG - Intronic
1008045327 6:46845812-46845834 GTGGGCACTTACCATATAATGGG - Intergenic
1011676453 6:89738991-89739013 GTGTCAACTGACCTTGTGGTGGG - Intronic
1012074164 6:94662289-94662311 GTGAATACATACCATATGATGGG + Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1017540915 6:155401667-155401689 GTGTCAACTTACCATATGATTGG - Intronic
1030969252 7:116034006-116034028 GTGAGAACTGACCATTTGATTGG - Intronic
1031774820 7:125894940-125894962 GTGTGTACTTAGCATATGCTAGG + Intergenic
1043094227 8:75946258-75946280 GTGGCAACTCACCAGAAGATAGG - Intergenic
1048111858 8:131476302-131476324 ATGTCTACTTACCATGTTATTGG - Intergenic
1050628007 9:7526399-7526421 GTGTCAACATACAATTTGAGGGG + Intergenic
1059427929 9:114232630-114232652 GTGTCACCTGACCACATGAGGGG - Intronic
1191058746 X:56272063-56272085 GTGTAAGCTTCCCATATGAAGGG + Intronic
1192336094 X:70221102-70221124 GTGCCAACCTACCAGATGTTGGG + Intergenic
1193693969 X:84683539-84683561 GTGTCCTCTAACCATATGGTTGG - Intergenic
1195090938 X:101458454-101458476 GTGTCAACTTAACATTCCATAGG - Intronic
1198870023 X:141168463-141168485 GTGTCAAGCTAACTTATGATTGG - Intergenic
1199281051 X:145999645-145999667 GTCTCCACTTACCAAATGGTAGG - Intergenic
1200313394 X:155103765-155103787 GTTTCAACTAACCATATATTTGG + Intronic
1200888261 Y:8294622-8294644 TTGTCAAATTAGCATATGAAAGG + Intergenic