ID: 1017542675

View in Genome Browser
Species Human (GRCh38)
Location 6:155418674-155418696
Sequence GACGCTTCCCACTGAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017542675 Original CRISPR GACGCTTCCCACTGAGGAAG TGG Intronic
901288949 1:8106936-8106958 GACGAGTGCCAATGAGGAAGTGG + Intergenic
901683007 1:10926403-10926425 AATACTTCCCACTGAGGAATTGG - Intergenic
904824665 1:33266501-33266523 GACGTTTCCCACATAGGAATTGG - Intronic
908251057 1:62266210-62266232 GATGGGTCACACTGAGGAAGTGG - Intronic
911143262 1:94528441-94528463 TTTGCTTCCCACTGTGGAAGGGG - Intergenic
911303707 1:96207247-96207269 GACTCTTCACAGTGAGAAAGTGG + Intergenic
911733080 1:101309883-101309905 GACGGGTCCGAATGAGGAAGTGG - Intergenic
912508732 1:110174237-110174259 GACCATTCCCACTGGGGAAGGGG - Intronic
920564080 1:206960030-206960052 GATGCCTCCCAGTGAGAAAGAGG + Intronic
1064471343 10:15639156-15639178 GGCACATCCCACTCAGGAAGGGG - Intronic
1067084702 10:43231612-43231634 GACGCTTCCCCGGGAGGAATGGG + Intronic
1069851211 10:71406289-71406311 GAGGCTTTCCTCTGGGGAAGAGG + Intronic
1070614414 10:77958522-77958544 GAGGCTACCCAATGAGGAAGTGG - Intergenic
1070636747 10:78134629-78134651 GAGACTTCCCTCTGAGAAAGGGG + Intergenic
1071505051 10:86227136-86227158 GCAGCTTCCCAGTGGGGAAGAGG + Intronic
1071729538 10:88234037-88234059 AGCGCATCCCACAGAGGAAGTGG + Intergenic
1076662662 10:132065721-132065743 GACGCTTCTCGGTGGGGAAGGGG - Intergenic
1076669260 10:132110773-132110795 GACCGTTCCCAGTGAAGAAGGGG + Intronic
1078762032 11:14259401-14259423 CACGCTGCCCACTGAGGAAACGG + Exonic
1085664315 11:78399985-78400007 GACATTTCACACTGAAGAAGTGG + Intronic
1089183553 11:116599223-116599245 GGAGCTCCCCACTGAGGGAGGGG - Intergenic
1089980124 11:122765387-122765409 GACGCTTCCCACTGAGCCCTGGG + Intronic
1090540801 11:127700968-127700990 GTTGCTTCCCACAGAGGTAGGGG - Intergenic
1090855896 11:130609160-130609182 GACTCCTCCCACTGAGAAAGTGG + Intergenic
1091562893 12:1628463-1628485 GACACTTGCCTCTTAGGAAGGGG + Intronic
1095954440 12:47798297-47798319 GACGCCTCCTACTGAGGATGGGG - Intronic
1096556087 12:52404868-52404890 GGTGCTGCCCAGTGAGGAAGGGG - Intronic
1099387457 12:82032183-82032205 GATGATTACCTCTGAGGAAGGGG + Intergenic
1104109281 12:125689998-125690020 GACCCATCCCACGCAGGAAGAGG + Intergenic
1109801873 13:67390587-67390609 CACTCTACCCACTGGGGAAGGGG - Intergenic
1110405155 13:75142889-75142911 CATGCTTCCCACTGTGGAACTGG + Intergenic
1112464246 13:99629630-99629652 GAGGCTTCCCACAGAGGGAAGGG + Intronic
1113379389 13:109787633-109787655 GACGCTTCCGAGGAAGGAAGGGG - Intergenic
1113838338 13:113344243-113344265 GAAGTTACCAACTGAGGAAGGGG + Intronic
1114474966 14:22987839-22987861 GGCCCTTCCCACTTAGGAAAGGG + Intronic
1115049423 14:29039181-29039203 GACAATTTCCACAGAGGAAGGGG + Intergenic
1117285092 14:54279179-54279201 GAGGCTTCAGGCTGAGGAAGTGG + Intergenic
1122870749 14:104637185-104637207 GTCGCCACCCACTGAGGAACGGG + Intergenic
1122870761 14:104637232-104637254 GTCGCCACCCACTGAGGAACGGG + Intergenic
1122870773 14:104637279-104637301 GTCGCCACCCACTGAGGAACGGG + Intergenic
1122870784 14:104637326-104637348 GTCGCCACCCACTGAGGAACGGG + Intergenic
1122870795 14:104637373-104637395 GTCGCCACCCACTGAGGAACGGG + Intergenic
1122976795 14:105174153-105174175 GCCACTGCCCACTGAGGGAGGGG - Intronic
1123933127 15:25181469-25181491 GACACTTGCCAATGGGGAAGGGG - Intergenic
1125873315 15:43122377-43122399 ACCGATTCCCACTAAGGAAGAGG - Intronic
1129826370 15:78637596-78637618 GGCCCTACCCACAGAGGAAGGGG - Intronic
1132827330 16:1911865-1911887 GACGCTCCCCGCTGACGAACAGG + Exonic
1134351289 16:13440217-13440239 GAGGCTTCCTTCTGAGGAAAGGG - Intergenic
1136078299 16:27832000-27832022 GAAAATGCCCACTGAGGAAGGGG - Intronic
1136619395 16:31418113-31418135 GACAGTGCCCACTGAGGATGAGG + Exonic
1137288760 16:47037695-47037717 GACGCCTCCCACCGTGGAACGGG - Intergenic
1140193786 16:72839828-72839850 GTCCCTTCCTACAGAGGAAGGGG - Intronic
1141173738 16:81706236-81706258 GACTCTTCCCACTGAGCCACGGG - Intronic
1142273333 16:89102491-89102513 GGGCCTCCCCACTGAGGAAGGGG - Intronic
1145733273 17:27209877-27209899 GATACTTCCCATTTAGGAAGTGG - Intergenic
1150184799 17:63169414-63169436 GATGCTTCCCAGTGCTGAAGTGG + Intronic
1151659564 17:75511760-75511782 GACGCTTCCCACTGGGCACAAGG + Intronic
1152648221 17:81480098-81480120 GGGGCTTCCCTCTGAGGCAGGGG - Intergenic
1153373820 18:4353276-4353298 AAGGCTTCCCACTGAGCACGGGG + Intronic
1157482597 18:48065072-48065094 TCTGCCTCCCACTGAGGAAGAGG + Intronic
1161422242 19:4182337-4182359 GGGACTTCCCAGTGAGGAAGGGG - Intronic
1164399453 19:27892666-27892688 GTCGCTTCCCTTTCAGGAAGAGG - Intergenic
1165077918 19:33291027-33291049 GATGCTTCCCAGGGAGGCAGAGG + Intergenic
1166724975 19:45021528-45021550 GAAGCTTCCAACTGATGAACTGG - Intronic
1167990845 19:53359077-53359099 GAAGCTCCCCACTGAGTAAAAGG + Intergenic
925807539 2:7665885-7665907 GATGCATTCCACTGCGGAAGGGG + Intergenic
928899489 2:36302025-36302047 GTCACTTCCTAGTGAGGAAGTGG - Intergenic
929882677 2:45850850-45850872 GATGCTTCCAACTGAAGAAATGG - Intronic
929885087 2:45871179-45871201 CAGGCCACCCACTGAGGAAGGGG - Intronic
934699546 2:96428708-96428730 GGGGCATCCCACTGAGGAAAAGG - Intergenic
935556918 2:104519985-104520007 GACTCTTCCCAATGTGGAGGTGG + Intergenic
936058915 2:109281869-109281891 GACGGTTCCCACTGAGAGGGAGG + Intronic
939166994 2:138650805-138650827 GCTTCTTCCCAGTGAGGAAGTGG - Intergenic
939658539 2:144858494-144858516 TAAGCTTCCCACAGAGGATGGGG + Intergenic
940437091 2:153668499-153668521 AACACTTGCCACTGAGGAACTGG + Intergenic
946944570 2:224807365-224807387 GAAGGTGTCCACTGAGGAAGGGG + Intronic
947353274 2:229268770-229268792 GTGGCTTCTCACTGAGGAATCGG + Intronic
948989184 2:241543239-241543261 GCCCCTTCCCACTGAGCCAGCGG + Intergenic
1168751869 20:288312-288334 AACACTTCCCAGTGAGGAAAAGG - Intronic
1169474956 20:5923035-5923057 GAGTCTTCCCTCTGAGGAAAAGG + Exonic
1171077415 20:22142635-22142657 GCCTCTTCCCAGAGAGGAAGAGG + Intergenic
1171285234 20:23931423-23931445 TAGGCTTTCCACTGAGGAACAGG - Intergenic
1171935925 20:31274700-31274722 GTCGCTTCTCACTGAGCCAGCGG - Intergenic
1173799336 20:45885155-45885177 GAGGCTTCCTACAGGGGAAGAGG + Exonic
1179121461 21:38550017-38550039 GACTCTGACCAATGAGGAAGGGG - Intronic
1180709571 22:17830736-17830758 TACTCTTCCCTCTGAGGCAGAGG - Intronic
1180735028 22:18010063-18010085 GATACTTCCCATTTAGGAAGTGG + Intronic
1183439006 22:37812695-37812717 GACAGTTCCCACTGAGGAACTGG - Intronic
1184045871 22:41971865-41971887 AACTCTTCCCAGTGAGAAAGTGG - Intergenic
1185388826 22:50548288-50548310 GACTGTCCCCACTGAAGAAGAGG - Exonic
949325429 3:2858086-2858108 GCAGCTTTCCACTGAGGAACAGG - Intronic
950143857 3:10634065-10634087 GACGCTTCCCTGTGAGGAGGTGG + Intronic
953871194 3:46629118-46629140 GAAGCTTCCCGGTCAGGAAGTGG - Intergenic
966927955 3:184657861-184657883 GCCCCTTCGCACTAAGGAAGGGG - Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
977573798 4:98657063-98657085 GCGGGTGCCCACTGAGGAAGAGG + Intronic
984349240 4:178569798-178569820 GGGGCATCCCACTGAGGAAAGGG - Intergenic
984567681 4:181350238-181350260 GTCATTACCCACTGAGGAAGAGG - Intergenic
985095342 4:186407567-186407589 GCTGCCCCCCACTGAGGAAGTGG + Intergenic
990722717 5:58715810-58715832 GAAGCTTGCCAATCAGGAAGAGG + Intronic
999608985 5:153349203-153349225 GACCCTTGGCACTGAGGAATAGG + Intergenic
1002236838 5:177808842-177808864 AACGGTTGCCTCTGAGGAAGGGG + Intergenic
1002475935 5:179466159-179466181 CAGGCTTCCAACAGAGGAAGTGG + Intergenic
1004527556 6:16423583-16423605 GACGCTCCCCAGTGAGGTGGAGG + Intronic
1006020978 6:31117434-31117456 CACCCTTCCCAGTGAGGCAGGGG + Exonic
1007341243 6:41192658-41192680 GACGCTTCCACCTGGGGAGGAGG - Intronic
1007359200 6:41342995-41343017 GACACTTCCCACTGAGCCACAGG + Intronic
1013596562 6:111665939-111665961 TACACTTCCAACTGAGGAGGTGG + Intronic
1017039385 6:150295535-150295557 GAGGCTTCCTATGGAGGAAGAGG + Intergenic
1017542675 6:155418674-155418696 GACGCTTCCCACTGAGGAAGTGG + Intronic
1017648722 6:156562387-156562409 GACGCTCCCATCTGAGCAAGGGG - Intergenic
1019311456 7:363556-363578 GAGTCTTCCCACTAAGGAAAGGG - Intergenic
1019536963 7:1534233-1534255 CACCCTTCCTACTGAGGATGAGG - Intronic
1020705721 7:11541612-11541634 CAGGCTTCAAACTGAGGAAGCGG - Exonic
1026903006 7:74047396-74047418 GATGCTTTCCACTGAGGAGGGGG + Intronic
1033760190 7:144429205-144429227 GACATTTCCCAAGGAGGAAGAGG + Intergenic
1034277061 7:149828673-149828695 CAGGCCTCCCACTGAGGCAGAGG - Intergenic
1036662175 8:10715618-10715640 CCCGATTCCCGCTGAGGAAGAGG - Intergenic
1036946006 8:13095554-13095576 GACGCTCCTAACTGAGGAAACGG - Intronic
1038348368 8:26753082-26753104 GAGGAGTCCCACTGAGGGAGTGG + Intronic
1038642288 8:29338139-29338161 AAGCCTTCCCAATGAGGAAGAGG + Intronic
1041503816 8:58571367-58571389 GAGGCTTCCCAAAGAGGAGGTGG - Intronic
1046698651 8:117374437-117374459 GACTCTGACCTCTGAGGAAGGGG - Intergenic
1046754527 8:117959460-117959482 GAAGCATACCACTAAGGAAGAGG + Intronic
1048946582 8:139454025-139454047 TCTGCTTCCCACTGAGGATGAGG + Intergenic
1049381537 8:142318895-142318917 GATGATTCCCACAGAGAAAGAGG + Intronic
1056860319 9:90175160-90175182 GGAGCTTCCCACTGTGGGAGAGG - Intergenic
1058512713 9:105737548-105737570 GACTCTACTCTCTGAGGAAGTGG + Intronic
1059277285 9:113107558-113107580 GCCTTTTCCCACAGAGGAAGAGG + Intergenic
1059278966 9:113116993-113117015 GCCTTTTCCCACAGAGGAAGAGG - Intergenic
1060796073 9:126514013-126514035 AGAGCTTCCCGCTGAGGAAGAGG + Intergenic
1060970421 9:127734589-127734611 GACACATCCCACCGAGGCAGAGG + Intronic
1062059547 9:134487593-134487615 GTCCCTCCTCACTGAGGAAGGGG - Intergenic
1062178894 9:135180098-135180120 GACACTTCCCTCCGAGGAATAGG - Intergenic
1062323718 9:136002932-136002954 GGCACTTCCCAGTGACGAAGGGG - Intergenic
1186673783 X:11794390-11794412 GAGGCTTCACACTGAGTAGGTGG - Intergenic
1188546665 X:31314894-31314916 GAGTTTTCCCACTGAGAAAGGGG + Intronic
1188625734 X:32282938-32282960 GACTCTTCCTACAGTGGAAGGGG - Intronic