ID: 1017545142

View in Genome Browser
Species Human (GRCh38)
Location 6:155442593-155442615
Sequence TCAACCACAAAGAAAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017545140_1017545142 9 Left 1017545140 6:155442561-155442583 CCAATATGGTGGTATGTGGAAAA 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1017545142 6:155442593-155442615 TCAACCACAAAGAAAGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017545142 Original CRISPR TCAACCACAAAGAAAGAGGT AGG Intronic
No off target data available for this crispr