ID: 1017546723

View in Genome Browser
Species Human (GRCh38)
Location 6:155459806-155459828
Sequence AAAGCCCACATCATCTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017546723_1017546727 18 Left 1017546723 6:155459806-155459828 CCACAAAAGATGATGTGGGCTTT No data
Right 1017546727 6:155459847-155459869 CAGTAACAAACCTACTATAATGG No data
1017546723_1017546729 28 Left 1017546723 6:155459806-155459828 CCACAAAAGATGATGTGGGCTTT No data
Right 1017546729 6:155459857-155459879 CCTACTATAATGGAAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017546723 Original CRISPR AAAGCCCACATCATCTTTTG TGG (reversed) Intergenic
No off target data available for this crispr