ID: 1017546727

View in Genome Browser
Species Human (GRCh38)
Location 6:155459847-155459869
Sequence CAGTAACAAACCTACTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017546723_1017546727 18 Left 1017546723 6:155459806-155459828 CCACAAAAGATGATGTGGGCTTT No data
Right 1017546727 6:155459847-155459869 CAGTAACAAACCTACTATAATGG No data
1017546724_1017546727 -7 Left 1017546724 6:155459831-155459853 CCCTTGTAAATCTCACCAGTAAC No data
Right 1017546727 6:155459847-155459869 CAGTAACAAACCTACTATAATGG No data
1017546725_1017546727 -8 Left 1017546725 6:155459832-155459854 CCTTGTAAATCTCACCAGTAACA No data
Right 1017546727 6:155459847-155459869 CAGTAACAAACCTACTATAATGG No data
1017546720_1017546727 26 Left 1017546720 6:155459798-155459820 CCAGCTCACCACAAAAGATGATG No data
Right 1017546727 6:155459847-155459869 CAGTAACAAACCTACTATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017546727 Original CRISPR CAGTAACAAACCTACTATAA TGG Intergenic
No off target data available for this crispr