ID: 1017550884

View in Genome Browser
Species Human (GRCh38)
Location 6:155506063-155506085
Sequence CGTGCCAAGATGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017550879_1017550884 -1 Left 1017550879 6:155506041-155506063 CCCAGGTAAGATCAGTGGGTTAC No data
Right 1017550884 6:155506063-155506085 CGTGCCAAGATGAAGGTGGAGGG No data
1017550880_1017550884 -2 Left 1017550880 6:155506042-155506064 CCAGGTAAGATCAGTGGGTTACG No data
Right 1017550884 6:155506063-155506085 CGTGCCAAGATGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017550884 Original CRISPR CGTGCCAAGATGAAGGTGGA GGG Intergenic
No off target data available for this crispr