ID: 1017556797

View in Genome Browser
Species Human (GRCh38)
Location 6:155580343-155580365
Sequence TGCATGAAATGCAACAGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017556791_1017556797 24 Left 1017556791 6:155580296-155580318 CCACTGCTGACTCCTGCCAATGA No data
Right 1017556797 6:155580343-155580365 TGCATGAAATGCAACAGTGCCGG No data
1017556795_1017556797 8 Left 1017556795 6:155580312-155580334 CCAATGAAGTGGCTAGAGGTCTC No data
Right 1017556797 6:155580343-155580365 TGCATGAAATGCAACAGTGCCGG No data
1017556793_1017556797 12 Left 1017556793 6:155580308-155580330 CCTGCCAATGAAGTGGCTAGAGG No data
Right 1017556797 6:155580343-155580365 TGCATGAAATGCAACAGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017556797 Original CRISPR TGCATGAAATGCAACAGTGC CGG Intergenic
No off target data available for this crispr