ID: 1017557745

View in Genome Browser
Species Human (GRCh38)
Location 6:155590385-155590407
Sequence TGGTTTTGCCAGATGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017557741_1017557745 0 Left 1017557741 6:155590362-155590384 CCTGCCTTGACAAATTACAATGA No data
Right 1017557745 6:155590385-155590407 TGGTTTTGCCAGATGGAATATGG No data
1017557743_1017557745 -4 Left 1017557743 6:155590366-155590388 CCTTGACAAATTACAATGATGGT No data
Right 1017557745 6:155590385-155590407 TGGTTTTGCCAGATGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017557745 Original CRISPR TGGTTTTGCCAGATGGAATA TGG Intergenic
No off target data available for this crispr