ID: 1017566881

View in Genome Browser
Species Human (GRCh38)
Location 6:155696324-155696346
Sequence CCCGCAGTGAATGCCTGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017566881_1017566883 12 Left 1017566881 6:155696324-155696346 CCGAGGCAGGCATTCACTGCGGG No data
Right 1017566883 6:155696359-155696381 ACAAGTAAATGATAAATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017566881 Original CRISPR CCCGCAGTGAATGCCTGCCT CGG (reversed) Intergenic
No off target data available for this crispr