ID: 1017568613

View in Genome Browser
Species Human (GRCh38)
Location 6:155716040-155716062
Sequence GCTCACAAACTGAAGGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017568613_1017568621 18 Left 1017568613 6:155716040-155716062 CCCAATACCTTCAGTTTGTGAGC No data
Right 1017568621 6:155716081-155716103 CCAGTGGCTTAAAGAGTGAATGG No data
1017568613_1017568623 20 Left 1017568613 6:155716040-155716062 CCCAATACCTTCAGTTTGTGAGC No data
Right 1017568623 6:155716083-155716105 AGTGGCTTAAAGAGTGAATGGGG No data
1017568613_1017568622 19 Left 1017568613 6:155716040-155716062 CCCAATACCTTCAGTTTGTGAGC No data
Right 1017568622 6:155716082-155716104 CAGTGGCTTAAAGAGTGAATGGG No data
1017568613_1017568617 2 Left 1017568613 6:155716040-155716062 CCCAATACCTTCAGTTTGTGAGC No data
Right 1017568617 6:155716065-155716087 TGATGGATGTAAGACCCCAGTGG No data
1017568613_1017568624 28 Left 1017568613 6:155716040-155716062 CCCAATACCTTCAGTTTGTGAGC No data
Right 1017568624 6:155716091-155716113 AAAGAGTGAATGGGGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017568613 Original CRISPR GCTCACAAACTGAAGGTATT GGG (reversed) Intergenic
No off target data available for this crispr