ID: 1017574048

View in Genome Browser
Species Human (GRCh38)
Location 6:155781694-155781716
Sequence TTAGTTTCCCAGGTATTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017574048_1017574053 29 Left 1017574048 6:155781694-155781716 CCAATTAATACCTGGGAAACTAA No data
Right 1017574053 6:155781746-155781768 TGGTTTATATAAGTTGGATAAGG No data
1017574048_1017574052 23 Left 1017574048 6:155781694-155781716 CCAATTAATACCTGGGAAACTAA No data
Right 1017574052 6:155781740-155781762 TTGAGCTGGTTTATATAAGTTGG No data
1017574048_1017574050 9 Left 1017574048 6:155781694-155781716 CCAATTAATACCTGGGAAACTAA No data
Right 1017574050 6:155781726-155781748 AGTAAAATGCCTACTTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017574048 Original CRISPR TTAGTTTCCCAGGTATTAAT TGG (reversed) Intergenic
No off target data available for this crispr