ID: 1017575030

View in Genome Browser
Species Human (GRCh38)
Location 6:155792821-155792843
Sequence CGCCTCTTACAGGTGATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017575026_1017575030 22 Left 1017575026 6:155792776-155792798 CCAGAGCCAGAGTCTTGGAATTG No data
Right 1017575030 6:155792821-155792843 CGCCTCTTACAGGTGATTTATGG No data
1017575027_1017575030 16 Left 1017575027 6:155792782-155792804 CCAGAGTCTTGGAATTGTCTTAG No data
Right 1017575030 6:155792821-155792843 CGCCTCTTACAGGTGATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017575030 Original CRISPR CGCCTCTTACAGGTGATTTA TGG Intergenic
No off target data available for this crispr