ID: 1017575241

View in Genome Browser
Species Human (GRCh38)
Location 6:155794811-155794833
Sequence GTCCACGAATGACTTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017575238_1017575241 12 Left 1017575238 6:155794776-155794798 CCGACACTTAGGAATGGGAAAGG No data
Right 1017575241 6:155794811-155794833 GTCCACGAATGACTTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017575241 Original CRISPR GTCCACGAATGACTTCTGCA TGG Intergenic
No off target data available for this crispr