ID: 1017578832

View in Genome Browser
Species Human (GRCh38)
Location 6:155837652-155837674
Sequence CCTTCCCTCTGTGAGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017578830_1017578832 -3 Left 1017578830 6:155837632-155837654 CCTGACATCATTTTGCATTTCCT No data
Right 1017578832 6:155837652-155837674 CCTTCCCTCTGTGAGTTTTGAGG No data
1017578828_1017578832 17 Left 1017578828 6:155837612-155837634 CCTCCTGGATCTGTTTCTGTCCT No data
Right 1017578832 6:155837652-155837674 CCTTCCCTCTGTGAGTTTTGAGG No data
1017578829_1017578832 14 Left 1017578829 6:155837615-155837637 CCTGGATCTGTTTCTGTCCTGAC No data
Right 1017578832 6:155837652-155837674 CCTTCCCTCTGTGAGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017578832 Original CRISPR CCTTCCCTCTGTGAGTTTTG AGG Intergenic
No off target data available for this crispr