ID: 1017587081

View in Genome Browser
Species Human (GRCh38)
Location 6:155938269-155938291
Sequence AAGTGGGATTGGAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017587069_1017587081 30 Left 1017587069 6:155938216-155938238 CCTCTACGAAGGGCAGATGCACA No data
Right 1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG No data
1017587073_1017587081 6 Left 1017587073 6:155938240-155938262 CCATTTGCTAAAAGAGGGGAAAA No data
Right 1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017587081 Original CRISPR AAGTGGGATTGGAGGGAAGG TGG Intergenic
No off target data available for this crispr