ID: 1017596423

View in Genome Browser
Species Human (GRCh38)
Location 6:156033974-156033996
Sequence AAAAATCCACAGATCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017596423_1017596426 7 Left 1017596423 6:156033974-156033996 CCTTCCTGGATCTGTGGATTTTT No data
Right 1017596426 6:156034004-156034026 ATCAATTAAAATAAATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017596423 Original CRISPR AAAAATCCACAGATCCAGGA AGG (reversed) Intergenic
No off target data available for this crispr