ID: 1017602982

View in Genome Browser
Species Human (GRCh38)
Location 6:156103516-156103538
Sequence CAGAATCACTTTAACTTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017602978_1017602982 -8 Left 1017602978 6:156103501-156103523 CCCCCTTTAGTCATTCAGAATCA No data
Right 1017602982 6:156103516-156103538 CAGAATCACTTTAACTTAAATGG No data
1017602976_1017602982 11 Left 1017602976 6:156103482-156103504 CCGTTGGAGCTCCACAGGACCCC No data
Right 1017602982 6:156103516-156103538 CAGAATCACTTTAACTTAAATGG No data
1017602980_1017602982 -10 Left 1017602980 6:156103503-156103525 CCCTTTAGTCATTCAGAATCACT No data
Right 1017602982 6:156103516-156103538 CAGAATCACTTTAACTTAAATGG No data
1017602977_1017602982 0 Left 1017602977 6:156103493-156103515 CCACAGGACCCCCTTTAGTCATT No data
Right 1017602982 6:156103516-156103538 CAGAATCACTTTAACTTAAATGG No data
1017602979_1017602982 -9 Left 1017602979 6:156103502-156103524 CCCCTTTAGTCATTCAGAATCAC No data
Right 1017602982 6:156103516-156103538 CAGAATCACTTTAACTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017602982 Original CRISPR CAGAATCACTTTAACTTAAA TGG Intergenic
No off target data available for this crispr