ID: 1017603129

View in Genome Browser
Species Human (GRCh38)
Location 6:156105033-156105055
Sequence CACCCAATGCTGCCCTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017603127_1017603129 2 Left 1017603127 6:156105008-156105030 CCTAACATGTAATTGAGAGGCTC No data
Right 1017603129 6:156105033-156105055 CACCCAATGCTGCCCTTGACAGG No data
1017603125_1017603129 25 Left 1017603125 6:156104985-156105007 CCGAGGTCTGGGTGTCTTCACTT No data
Right 1017603129 6:156105033-156105055 CACCCAATGCTGCCCTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017603129 Original CRISPR CACCCAATGCTGCCCTTGAC AGG Intergenic
No off target data available for this crispr