ID: 1017611459

View in Genome Browser
Species Human (GRCh38)
Location 6:156190789-156190811
Sequence CAGCACAAGGTGAAGAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017611459_1017611465 21 Left 1017611459 6:156190789-156190811 CCGGCCTTCTTCACCTTGTGCTG No data
Right 1017611465 6:156190833-156190855 CATCTGTGTTCATTTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017611459 Original CRISPR CAGCACAAGGTGAAGAAGGC CGG (reversed) Intergenic
No off target data available for this crispr