ID: 1017612304

View in Genome Browser
Species Human (GRCh38)
Location 6:156201566-156201588
Sequence AAACATCCACTGATGGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017612302_1017612304 -6 Left 1017612302 6:156201549-156201571 CCAACAAAAAACAGCATAAACAT No data
Right 1017612304 6:156201566-156201588 AAACATCCACTGATGGATAAAGG No data
1017612301_1017612304 17 Left 1017612301 6:156201526-156201548 CCAAGAGGTAAAAAACAAACAAG No data
Right 1017612304 6:156201566-156201588 AAACATCCACTGATGGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017612304 Original CRISPR AAACATCCACTGATGGATAA AGG Intergenic
No off target data available for this crispr