ID: 1017616765

View in Genome Browser
Species Human (GRCh38)
Location 6:156254295-156254317
Sequence CTGTGTCAGGGGCAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017616765_1017616775 17 Left 1017616765 6:156254295-156254317 CCTGCAGCCTGCCCCTGACACAG No data
Right 1017616775 6:156254335-156254357 ACCCTCCAAGGGAAACAGCCAGG No data
1017616765_1017616773 5 Left 1017616765 6:156254295-156254317 CCTGCAGCCTGCCCCTGACACAG No data
Right 1017616773 6:156254323-156254345 CAGCAGGTGCTTACCCTCCAAGG No data
1017616765_1017616774 6 Left 1017616765 6:156254295-156254317 CCTGCAGCCTGCCCCTGACACAG No data
Right 1017616774 6:156254324-156254346 AGCAGGTGCTTACCCTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017616765 Original CRISPR CTGTGTCAGGGGCAGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr