ID: 1017620112

View in Genome Browser
Species Human (GRCh38)
Location 6:156287823-156287845
Sequence TAAAATGCACATATGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017620106_1017620112 8 Left 1017620106 6:156287792-156287814 CCTTCCAGAATGTTTCATATAAA No data
Right 1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG No data
1017620107_1017620112 4 Left 1017620107 6:156287796-156287818 CCAGAATGTTTCATATAAATACA No data
Right 1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017620112 Original CRISPR TAAAATGCACATATGGGGCT GGG Intergenic
No off target data available for this crispr