ID: 1017620548

View in Genome Browser
Species Human (GRCh38)
Location 6:156292177-156292199
Sequence CCTTGTGAGCAGACAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017620538_1017620548 27 Left 1017620538 6:156292127-156292149 CCCAGAGGTATCTCAGAGGAAAC No data
Right 1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG No data
1017620537_1017620548 28 Left 1017620537 6:156292126-156292148 CCCCAGAGGTATCTCAGAGGAAA No data
Right 1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG No data
1017620539_1017620548 26 Left 1017620539 6:156292128-156292150 CCAGAGGTATCTCAGAGGAAACG No data
Right 1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG No data
1017620543_1017620548 -8 Left 1017620543 6:156292162-156292184 CCTAGATGCCTGCACCCTTGTGA No data
Right 1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG No data
1017620542_1017620548 -2 Left 1017620542 6:156292156-156292178 CCTGTTCCTAGATGCCTGCACCC No data
Right 1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG No data
1017620536_1017620548 29 Left 1017620536 6:156292125-156292147 CCCCCAGAGGTATCTCAGAGGAA No data
Right 1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017620548 Original CRISPR CCTTGTGAGCAGACAGAGGA AGG Intergenic
No off target data available for this crispr