ID: 1017621795

View in Genome Browser
Species Human (GRCh38)
Location 6:156306851-156306873
Sequence TTTACCAGTTCTGTGAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017621795_1017621796 -8 Left 1017621795 6:156306851-156306873 CCTCATTTCACAGAACTGGTAAA No data
Right 1017621796 6:156306866-156306888 CTGGTAAACTCCAGCACCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017621795 Original CRISPR TTTACCAGTTCTGTGAAATG AGG (reversed) Intergenic
No off target data available for this crispr