ID: 1017622185

View in Genome Browser
Species Human (GRCh38)
Location 6:156310339-156310361
Sequence TAGCAGAGCCACTGCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017622185_1017622189 3 Left 1017622185 6:156310339-156310361 CCACCTCTGCAGTGGCTCTGCTA No data
Right 1017622189 6:156310365-156310387 GCTAACTACAAGAATTACTTGGG No data
1017622185_1017622188 2 Left 1017622185 6:156310339-156310361 CCACCTCTGCAGTGGCTCTGCTA No data
Right 1017622188 6:156310364-156310386 TGCTAACTACAAGAATTACTTGG No data
1017622185_1017622190 4 Left 1017622185 6:156310339-156310361 CCACCTCTGCAGTGGCTCTGCTA No data
Right 1017622190 6:156310366-156310388 CTAACTACAAGAATTACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017622185 Original CRISPR TAGCAGAGCCACTGCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr