ID: 1017633246

View in Genome Browser
Species Human (GRCh38)
Location 6:156419960-156419982
Sequence TACACTTTTGTCTACACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017633243_1017633246 18 Left 1017633243 6:156419919-156419941 CCAAATATTATAGGTTGAGGCAG No data
Right 1017633246 6:156419960-156419982 TACACTTTTGTCTACACAGGTGG No data
1017633242_1017633246 19 Left 1017633242 6:156419918-156419940 CCCAAATATTATAGGTTGAGGCA No data
Right 1017633246 6:156419960-156419982 TACACTTTTGTCTACACAGGTGG No data
1017633241_1017633246 20 Left 1017633241 6:156419917-156419939 CCCCAAATATTATAGGTTGAGGC No data
Right 1017633246 6:156419960-156419982 TACACTTTTGTCTACACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017633246 Original CRISPR TACACTTTTGTCTACACAGG TGG Intergenic
No off target data available for this crispr