ID: 1017639028

View in Genome Browser
Species Human (GRCh38)
Location 6:156472297-156472319
Sequence ACACTATGAGGCTGTTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017639028_1017639035 18 Left 1017639028 6:156472297-156472319 CCCTCAAAACAGCCTCATAGTGT No data
Right 1017639035 6:156472338-156472360 CCTTACAGGTGAGAAAACTGAGG No data
1017639028_1017639031 4 Left 1017639028 6:156472297-156472319 CCCTCAAAACAGCCTCATAGTGT No data
Right 1017639031 6:156472324-156472346 GACATTAATTCCCACCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017639028 Original CRISPR ACACTATGAGGCTGTTTTGA GGG (reversed) Intergenic
No off target data available for this crispr