ID: 1017639029

View in Genome Browser
Species Human (GRCh38)
Location 6:156472298-156472320
Sequence TACACTATGAGGCTGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017639029_1017639031 3 Left 1017639029 6:156472298-156472320 CCTCAAAACAGCCTCATAGTGTA No data
Right 1017639031 6:156472324-156472346 GACATTAATTCCCACCTTACAGG No data
1017639029_1017639035 17 Left 1017639029 6:156472298-156472320 CCTCAAAACAGCCTCATAGTGTA No data
Right 1017639035 6:156472338-156472360 CCTTACAGGTGAGAAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017639029 Original CRISPR TACACTATGAGGCTGTTTTG AGG (reversed) Intergenic
No off target data available for this crispr