ID: 1017639030

View in Genome Browser
Species Human (GRCh38)
Location 6:156472309-156472331
Sequence TTAATGTCATTTACACTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017639030_1017639035 6 Left 1017639030 6:156472309-156472331 CCTCATAGTGTAAATGACATTAA No data
Right 1017639035 6:156472338-156472360 CCTTACAGGTGAGAAAACTGAGG No data
1017639030_1017639031 -8 Left 1017639030 6:156472309-156472331 CCTCATAGTGTAAATGACATTAA No data
Right 1017639031 6:156472324-156472346 GACATTAATTCCCACCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017639030 Original CRISPR TTAATGTCATTTACACTATG AGG (reversed) Intergenic