ID: 1017639031

View in Genome Browser
Species Human (GRCh38)
Location 6:156472324-156472346
Sequence GACATTAATTCCCACCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017639030_1017639031 -8 Left 1017639030 6:156472309-156472331 CCTCATAGTGTAAATGACATTAA No data
Right 1017639031 6:156472324-156472346 GACATTAATTCCCACCTTACAGG No data
1017639028_1017639031 4 Left 1017639028 6:156472297-156472319 CCCTCAAAACAGCCTCATAGTGT No data
Right 1017639031 6:156472324-156472346 GACATTAATTCCCACCTTACAGG No data
1017639029_1017639031 3 Left 1017639029 6:156472298-156472320 CCTCAAAACAGCCTCATAGTGTA No data
Right 1017639031 6:156472324-156472346 GACATTAATTCCCACCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017639031 Original CRISPR GACATTAATTCCCACCTTAC AGG Intergenic
No off target data available for this crispr