ID: 1017641065

View in Genome Browser
Species Human (GRCh38)
Location 6:156494449-156494471
Sequence CTCCCCAACCCAATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017641055_1017641065 9 Left 1017641055 6:156494417-156494439 CCCCTCACTCCTCTCTCCTGGCC No data
Right 1017641065 6:156494449-156494471 CTCCCCAACCCAATGGAGCTAGG No data
1017641059_1017641065 -7 Left 1017641059 6:156494433-156494455 CCTGGCCCTTTTTTCCCTCCCCA No data
Right 1017641065 6:156494449-156494471 CTCCCCAACCCAATGGAGCTAGG No data
1017641053_1017641065 26 Left 1017641053 6:156494400-156494422 CCAGAAATTCAAGAGGACCCCTC No data
Right 1017641065 6:156494449-156494471 CTCCCCAACCCAATGGAGCTAGG No data
1017641058_1017641065 0 Left 1017641058 6:156494426-156494448 CCTCTCTCCTGGCCCTTTTTTCC No data
Right 1017641065 6:156494449-156494471 CTCCCCAACCCAATGGAGCTAGG No data
1017641057_1017641065 7 Left 1017641057 6:156494419-156494441 CCTCACTCCTCTCTCCTGGCCCT No data
Right 1017641065 6:156494449-156494471 CTCCCCAACCCAATGGAGCTAGG No data
1017641056_1017641065 8 Left 1017641056 6:156494418-156494440 CCCTCACTCCTCTCTCCTGGCCC No data
Right 1017641065 6:156494449-156494471 CTCCCCAACCCAATGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017641065 Original CRISPR CTCCCCAACCCAATGGAGCT AGG Intergenic
No off target data available for this crispr