ID: 1017643114

View in Genome Browser
Species Human (GRCh38)
Location 6:156513428-156513450
Sequence AGTCAATCCCAAAGATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017643103_1017643114 27 Left 1017643103 6:156513378-156513400 CCCCACTGCTCCAACCTTTCTGG No data
Right 1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG No data
1017643109_1017643114 13 Left 1017643109 6:156513392-156513414 CCTTTCTGGACTGTACCAGTGGA No data
Right 1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG No data
1017643102_1017643114 30 Left 1017643102 6:156513375-156513397 CCACCCCACTGCTCCAACCTTTC No data
Right 1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG No data
1017643107_1017643114 17 Left 1017643107 6:156513388-156513410 CCAACCTTTCTGGACTGTACCAG No data
Right 1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG No data
1017643106_1017643114 25 Left 1017643106 6:156513380-156513402 CCACTGCTCCAACCTTTCTGGAC No data
Right 1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG No data
1017643105_1017643114 26 Left 1017643105 6:156513379-156513401 CCCACTGCTCCAACCTTTCTGGA No data
Right 1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG No data
1017643110_1017643114 -2 Left 1017643110 6:156513407-156513429 CCAGTGGAGTCCTCCAAACACAG No data
Right 1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017643114 Original CRISPR AGTCAATCCCAAAGATGTCT GGG Intergenic