ID: 1017649067

View in Genome Browser
Species Human (GRCh38)
Location 6:156564595-156564617
Sequence CCGAGTCGCCGGCCTTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017649067_1017649079 6 Left 1017649067 6:156564595-156564617 CCCCTCCAAGGCCGGCGACTCGG No data
Right 1017649079 6:156564624-156564646 GGGCCGCCAAGCCCTGCATGGGG No data
1017649067_1017649084 19 Left 1017649067 6:156564595-156564617 CCCCTCCAAGGCCGGCGACTCGG No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data
1017649067_1017649085 24 Left 1017649067 6:156564595-156564617 CCCCTCCAAGGCCGGCGACTCGG No data
Right 1017649085 6:156564642-156564664 TGGGGTGTTTATCGTTGGAAAGG No data
1017649067_1017649077 4 Left 1017649067 6:156564595-156564617 CCCCTCCAAGGCCGGCGACTCGG No data
Right 1017649077 6:156564622-156564644 CTGGGCCGCCAAGCCCTGCATGG No data
1017649067_1017649086 25 Left 1017649067 6:156564595-156564617 CCCCTCCAAGGCCGGCGACTCGG No data
Right 1017649086 6:156564643-156564665 GGGGTGTTTATCGTTGGAAAGGG No data
1017649067_1017649078 5 Left 1017649067 6:156564595-156564617 CCCCTCCAAGGCCGGCGACTCGG No data
Right 1017649078 6:156564623-156564645 TGGGCCGCCAAGCCCTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017649067 Original CRISPR CCGAGTCGCCGGCCTTGGAG GGG (reversed) Intergenic