ID: 1017649075

View in Genome Browser
Species Human (GRCh38)
Location 6:156564618-156564640
Sequence GCAGGGCTTGGCGGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017649075_1017649084 -4 Left 1017649075 6:156564618-156564640 CCACCTGGGCCGCCAAGCCCTGC No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data
1017649075_1017649085 1 Left 1017649075 6:156564618-156564640 CCACCTGGGCCGCCAAGCCCTGC No data
Right 1017649085 6:156564642-156564664 TGGGGTGTTTATCGTTGGAAAGG No data
1017649075_1017649086 2 Left 1017649075 6:156564618-156564640 CCACCTGGGCCGCCAAGCCCTGC No data
Right 1017649086 6:156564643-156564665 GGGGTGTTTATCGTTGGAAAGGG No data
1017649075_1017649087 29 Left 1017649075 6:156564618-156564640 CCACCTGGGCCGCCAAGCCCTGC No data
Right 1017649087 6:156564670-156564692 TTTCAGAACCTATAGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017649075 Original CRISPR GCAGGGCTTGGCGGCCCAGG TGG (reversed) Intergenic