ID: 1017649080

View in Genome Browser
Species Human (GRCh38)
Location 6:156564627-156564649
Sequence ACACCCCATGCAGGGCTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017649080_1017649086 -7 Left 1017649080 6:156564627-156564649 CCGCCAAGCCCTGCATGGGGTGT No data
Right 1017649086 6:156564643-156564665 GGGGTGTTTATCGTTGGAAAGGG No data
1017649080_1017649088 23 Left 1017649080 6:156564627-156564649 CCGCCAAGCCCTGCATGGGGTGT No data
Right 1017649088 6:156564673-156564695 CAGAACCTATAGCACCTTGGTGG No data
1017649080_1017649085 -8 Left 1017649080 6:156564627-156564649 CCGCCAAGCCCTGCATGGGGTGT No data
Right 1017649085 6:156564642-156564664 TGGGGTGTTTATCGTTGGAAAGG No data
1017649080_1017649087 20 Left 1017649080 6:156564627-156564649 CCGCCAAGCCCTGCATGGGGTGT No data
Right 1017649087 6:156564670-156564692 TTTCAGAACCTATAGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017649080 Original CRISPR ACACCCCATGCAGGGCTTGG CGG (reversed) Intergenic