ID: 1017649084

View in Genome Browser
Species Human (GRCh38)
Location 6:156564637-156564659
Sequence CTGCATGGGGTGTTTATCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017649075_1017649084 -4 Left 1017649075 6:156564618-156564640 CCACCTGGGCCGCCAAGCCCTGC No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data
1017649067_1017649084 19 Left 1017649067 6:156564595-156564617 CCCCTCCAAGGCCGGCGACTCGG No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data
1017649071_1017649084 14 Left 1017649071 6:156564600-156564622 CCAAGGCCGGCGACTCGGCCACC No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data
1017649066_1017649084 20 Left 1017649066 6:156564594-156564616 CCCCCTCCAAGGCCGGCGACTCG No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data
1017649069_1017649084 18 Left 1017649069 6:156564596-156564618 CCCTCCAAGGCCGGCGACTCGGC No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data
1017649076_1017649084 -7 Left 1017649076 6:156564621-156564643 CCTGGGCCGCCAAGCCCTGCATG No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data
1017649070_1017649084 17 Left 1017649070 6:156564597-156564619 CCTCCAAGGCCGGCGACTCGGCC No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data
1017649074_1017649084 8 Left 1017649074 6:156564606-156564628 CCGGCGACTCGGCCACCTGGGCC No data
Right 1017649084 6:156564637-156564659 CTGCATGGGGTGTTTATCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017649084 Original CRISPR CTGCATGGGGTGTTTATCGT TGG Intergenic