ID: 1017652884

View in Genome Browser
Species Human (GRCh38)
Location 6:156599272-156599294
Sequence GCCTGGGGCCCTTTCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017652884_1017652892 10 Left 1017652884 6:156599272-156599294 CCTGGCCAGAAAGGGCCCCAGGC No data
Right 1017652892 6:156599305-156599327 AAGCCTCTTAAGAACCCGGATGG No data
1017652884_1017652893 11 Left 1017652884 6:156599272-156599294 CCTGGCCAGAAAGGGCCCCAGGC No data
Right 1017652893 6:156599306-156599328 AGCCTCTTAAGAACCCGGATGGG No data
1017652884_1017652891 6 Left 1017652884 6:156599272-156599294 CCTGGCCAGAAAGGGCCCCAGGC No data
Right 1017652891 6:156599301-156599323 ATGGAAGCCTCTTAAGAACCCGG No data
1017652884_1017652897 25 Left 1017652884 6:156599272-156599294 CCTGGCCAGAAAGGGCCCCAGGC No data
Right 1017652897 6:156599320-156599342 CCGGATGGGAAGCTCCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017652884 Original CRISPR GCCTGGGGCCCTTTCTGGCC AGG (reversed) Intergenic
No off target data available for this crispr