ID: 1017654802

View in Genome Browser
Species Human (GRCh38)
Location 6:156617434-156617456
Sequence AGTGAGCAGCGGAAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017654802_1017654809 12 Left 1017654802 6:156617434-156617456 CCATCCATCTTCCGCTGCTCACT No data
Right 1017654809 6:156617469-156617491 TTCCTGTAGACCAGCTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017654802 Original CRISPR AGTGAGCAGCGGAAGATGGA TGG (reversed) Intergenic
No off target data available for this crispr